LXL04_003426 | RubberDandelionOmics

Gene overview

LXL04_003426

Reference: OH-1004 Chr: Chr01 Coordinates: 78363668-78366142 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · LXL04_003426|LXL04_003426|OH1004|cDNA

ATGCCTCTAACGTGTTCCGAAGTCGAGATGAGCCCCCACTCTAATTTGACACCTAGAGAGTATCAATTAGATGTGTTTCAAGTGGCTATGCGGCGAAATACCATAGCTCATCTGGACACTGATGCCGGGAAAACAATGATAGCCATCCTAATCATCAAACAAGTATACTATGATCAAATCGCTGATTTTGCTATCACTACTGGCGTTAAGTTTGTTACGAAATCCAAATCAATTTTGCAAATAACTCTTATGGATTTTCA...

CDS

Download CDS FASTA

498 bp · LXL04_003426|LXL04_003426|OH1004|CDS

ATGCCTCTAACGTGTTCCGAAGTCGAGATGAGCCCCCACTCTAATTTGACACCTAGAGAGTATCAATTAGATGTGTTTCAAGTGGCTATGCGGCGAAATACCATAGCTCATCTGGACACTGATGCCGGGAAAACAATGATAGCCATCCTAATCATCAAACAAGTATACTATGATCAAATCGCTGATTTTGCTATCACTACTGGCGTTAAGTTTGTTACGAAATCCAAATCAATTTTGCAAATAACTCTTATGGATTTTCA...

Protein

Download Protein FASTA

165 aa · LXL04_003426|LXL04_003426|OH1004|PROTEIN

MPLTCSEVEMSPHSNLTPREYQLDVFQVAMRRNTIAHLDTDAGKTMIAILIIKQVYYDQIADFAITTGVKFVTKSKSILQITLMDFQLQQFKVLKENTDLTVDFYHGTKVGTMNGKKCLSCGKEFQDDGDMALKIKCKCQAEVGVGWHTDGERLHEICIKSLPHW

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003426`
TK1151 ID	TkA01G361900
OH-1004 ID	LXL04_003426
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 94.545 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003426

Location Chr01:78363668-78366142 (+)

Description Similar to DCL3A: Endoribonuclease Dicer homolog 3a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0909200`	Probably involved in the RNA silencing pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003426 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010267 ta-siRNA processing Biological Process

GO:0030422 siRNA processing Biological Process

GO:0050688 regulation of defense response to virus Biological Process

GO:0051607 defense response to virus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0004386 helicase activity Molecular Function

GO:0004525 ribonuclease III activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

act:ACLA_014840

afm:AFUA_5G11790

dosa:Os01g0909200

osa:4324864

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.657

Rank 1 · LXL04_003426 · OH-1004

Cytoplasm0.331

Rank 2 · LXL04_003426 · OH-1004

Extracellular0.055

Rank 3 · LXL04_003426 · OH-1004

Mitochondrion0.044

Rank 4 · LXL04_003426 · OH-1004

Cell membrane0.032

Rank 5 · LXL04_003426 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5N870`	Oryza sativa subsp. japonica	Endoribonuclease Dicer homolog 3a	45.263%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card