LXL04_003381 | RubberDandelionOmics

Gene overview

LXL04_003381

Reference: OH-1004 Chr: Chr01 Coordinates: 77084605-77087723 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1521 bp · LXL04_003381|LXL04_003381|OH1004|cDNA

ATGGCATCTTCTAGGGTTTATACTGTACTTTTCTTCTGTGTTTTTGCAATCTTATCATCCAGTGTATCGATCTCTTCTGCTACCGAGGCGGAGAAAGAACATGTTTTGACTTTGGATCACTCAAATTTCTCAGAAGTTGTGTCTAAACACAAATTCCTAGTCGTTGAGTTCTACGCTCCTTGGTGCGGTCACTGTAAGAGCCTGGCTCCAGAGTATGAAAAGGCAGCATCTGTGTTATCAAGCAACGAGCCTCCAGTATT...

CDS

Download CDS FASTA

1521 bp · LXL04_003381|LXL04_003381|OH1004|CDS

ATGGCATCTTCTAGGGTTTATACTGTACTTTTCTTCTGTGTTTTTGCAATCTTATCATCCAGTGTATCGATCTCTTCTGCTACCGAGGCGGAGAAAGAACATGTTTTGACTTTGGATCACTCAAATTTCTCAGAAGTTGTGTCTAAACACAAATTCCTAGTCGTTGAGTTCTACGCTCCTTGGTGCGGTCACTGTAAGAGCCTGGCTCCAGAGTATGAAAAGGCAGCATCTGTGTTATCAAGCAACGAGCCTCCAGTATT...

Protein

Download Protein FASTA

506 aa · LXL04_003381|LXL04_003381|OH1004|PROTEIN

MASSRVYTVLFFCVFAILSSSVSISSATEAEKEHVLTLDHSNFSEVVSKHKFLVVEFYAPWCGHCKSLAPEYEKAASVLSSNEPPVFLAKVDANAEENKVLAQQYEIQGFPTIKILKNGGEVVQDYKGPREADGIVEYLKKQVGPASFEIKTPEDAASLIDEKKVFVVGIFPTFSGEEYENFTILADKLRSDYEFGHTTNAQLLPRGESSVTTPTIRLLKPFDELVVDFQTFEVDALEKFIEDASIPLVTLFDQSPSNQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003381`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003381

Location Chr01:77084605-77087723 (-)

Description Similar to Protein disulfide-isomerase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g21750`	Protein disulfide isomerase that associates with RD21A protease for trafficking from the ER through the Golgi to lytic and protein storage vacuoles of endothelial cells in developing seeds.	Arabidopsis protein disulfide isomerase-5 inhibits cysteine proteases during trafficking to vacuoles before programmed cell death of the endothelium in developing seeds.2008 · DOI: 10.1105/tpc.108.058339

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0199200`	Probable protein disulfide isomerase that plays an essential role in the segregation of proglutelin and prolamin polypeptides within the ER lumen of endosperm.	Protein disulfide isomerase like 1-1 participates in the maturation of proglutelin within the endoplasmic reticulum in rice endosperm.2010 · DOI: 10.1093/pcp/pcq098

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003381 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009960 endosperm development Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0034975 protein folding in endoplasmic reticulum Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0048316 seed development Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0000326 protein storage vacuole Cellular Component

GO:0000327 lytic vacuole within protein storage vacuole Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G21750

dosa:Os11g0199200

rcu:8281065

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.877

Rank 1 · LXL04_003381 · OH-1004

Cytoplasm0.120

Rank 2 · LXL04_003381 · OH-1004

Nucleus0.064

Rank 3 · LXL04_003381 · OH-1004

Lysosome / Vacuole0.059

Rank 4 · LXL04_003381 · OH-1004

Golgi apparatus0.057

Rank 5 · LXL04_003381 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04756.20OST3_OST631-160 aa

PF00085.27Thioredoxin35-141 aa

PF20207.5PedC-like37-126 aa

PF13098.14Thioredoxin_243-141 aa

PF13848.13Thioredoxin_6172-342 aa

PF00085.27Thioredoxin379-482 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003381	`PF04756.20`	OST3_OST6	31	160	3e-11	44.0
LXL04_003381	`PF00085.27`	Thioredoxin	35	141	2e-54	182.6
LXL04_003381	`PF20207.5`	PedC-like	37	126	2.5e-06	28.2
LXL04_003381	`PF13098.14`	Thioredoxin_2	43	141	1.1e-13	52.2
LXL04_003381	`PF13848.13`	Thioredoxin_6	172	342	1.5e-31	110.4
LXL04_003381	`PF00085.27`	Thioredoxin	379	482	2e-54	182.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI01`	Arabidopsis thaliana	Protein disulfide isomerase-like 1-1	59.958%	Swiss-Prot	strong database homology
`Q53LQ0`	Oryza sativa subsp. japonica	Protein disulfide isomerase-like 1-1	61.441%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card