LXL04_003357 | RubberDandelionOmics

Gene overview

LXL04_003357

Reference: OH-1004 Chr: Chr01 Coordinates: 76004052-76016348 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1380 bp · LXL04_003357|LXL04_003357|OH1004|cDNA

atgttaaatattgGAACCGAAAACCGGACCGATTATAGaCGGGACTCCGCtcatcttacgattagtgagagaataAACTCGATGAAGAAAGTGCGAGATTATGGTCGGGAGTCACCAAAACCAGCATCACCTGCTGGAATTTGCTGTAGAAAATGCTTAAATTTCAAGAATTCGGAAGTTAAAATTGGTTCGCTTTATGTTGTCGAGATCTTATGTGTACGTCGAATTTCTGTCAAATCAGTAACGAGATGGCAGACACC...

CDS

Download CDS FASTA

1380 bp · LXL04_003357|LXL04_003357|OH1004|CDS

ATGTTAAATATTGGAACCGAAAACCGGACCGATTATAGACGGGACTCCGCTCATCTTACGATTAGTGAGAGAATAAACTCGATGAAGAAAGTGCGAGATTATGGTCGGGAGTCACCAAAACCAGCATCACCTGCTGGAATTTGCTGTAGAAAATGCTTAAATTTCAAGAATTCGGAAGTTAAAATTGGTTCGCTTTATGTTGTCGAGATCTTATGTGTACGTCGAATTTCTGTCAAATCAGTAACGAGATGGCAGACACC...

Protein

Download Protein FASTA

459 aa · LXL04_003357|LXL04_003357|OH1004|PROTEIN

MLNIGTENRTDYRRDSAHLTISERINSMKKVRDYGRESPKPASPAGICCRKCLNFKNSEVKIGSLYVVEILCVRRISVKSVTRWQTPTRVVEASEGGDQLLEMEQEVRKWWDDKHLRSFSTDATRFSLADAGDRIDDANFVFETANAAILRLTIERLWMEEVIGAESSLRVGPASTYADHVFANEMNFAIKMTERNYGDYMFREALKSGIWDQDSEEYGTCWLAKCIPHRCEHGLYVAIYVGVFPLSTRALLERQSWAPH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003357`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003357

Location Chr01:76004052-76016348 (+)

Description Similar to At1g09620: Leucine--tRNA ligase, cytoplasmic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09620`	Catalyzes the specific attachment of an amino acid to its cognate tRNA in a two step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003357 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0006418 tRNA aminoacylation for protein translation Biological Process

GO:0006425 glutaminyl-tRNA aminoacylation Biological Process

GO:0006429 leucyl-tRNA aminoacylation Biological Process

GO:0008361 regulation of cell size Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032008 positive regulation of TOR signaling Biological Process

GO:0034198 cellular response to amino acid starvation Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0071230 cellular response to amino acid stimulus Biological Process

GO:0071233 cellular response to L-leucine Biological Process

GO:1904263 positive regulation of TORC1 signaling Biological Process

KEGG gene cross-reference

ath:AT1G09620

cel:CELE_R74.1

hsa:51520

mmu:107045

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.366

Rank 1 · LXL04_003357 · OH-1004

Cytoplasm0.356

Rank 2 · LXL04_003357 · OH-1004

Cell membrane0.146

Rank 3 · LXL04_003357 · OH-1004

Mitochondrion0.117

Rank 4 · LXL04_003357 · OH-1004

Plastid0.081

Rank 5 · LXL04_003357 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I116`	Arabidopsis thaliana	Leucine--tRNA ligase, cytoplasmic	65.657%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card