LXL04_003232 | RubberDandelionOmics

Gene overview

LXL04_003232

Reference: OH-1004 Chr: Chr01 Coordinates: 71506364-71510016 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · LXL04_003232|LXL04_003232|OH1004|cDNA

ATGACGCCCTTCCCTAAAAGTTCCGCCACAAGTTTCTTTTTGATTCACACCACCGACGGCATGAACAAATCCGACATGAGAAAGGCATCAAAACATGAAGACGGGGCTGATTTGATCAGCAACTTGCCAGATCACATCCTTCTTTTGATTCTCTCGGGACTTCCATCTACCGAAGAAATAATCCGAACAAGCATTTTGTCCAGACGATGGAGGTATTTGTGGACTTCAATTCCCTCTCTAGACTTGGTATATCCCCGAGA...

CDS

Download CDS FASTA

1359 bp · LXL04_003232|LXL04_003232|OH1004|CDS

ATGACGCCCTTCCCTAAAAGTTCCGCCACAAGTTTCTTTTTGATTCACACCACCGACGGCATGAACAAATCCGACATGAGAAAGGCATCAAAACATGAAGACGGGGCTGATTTGATCAGCAACTTGCCAGATCACATCCTTCTTTTGATTCTCTCGGGACTTCCATCTACCGAAGAAATAATCCGAACAAGCATTTTGTCCAGACGATGGAGGTATTTGTGGACTTCAATTCCCTCTCTAGACTTGGTATATCCCCGAGA...

Protein

Download Protein FASTA

452 aa · LXL04_003232|LXL04_003232|OH1004|PROTEIN

MTPFPKSSATSFFLIHTTDGMNKSDMRKASKHEDGADLISNLPDHILLLILSGLPSTEEIIRTSILSRRWRYLWTSIPSLDLVYPRERKPSGKSNYSKFKEFVDWVLLNRSADLDSFRVSHSLYYSMSTIERWIHAAVMRNVKQLDLVFPSNWKSEDMAMPVCASLEVLRVIQRINGDSVKDFLESCPMLEDLTLDNCRLDKLDRLTPIRRCETSTSVAVFTLHVVYRRRCETSVAVSFVLTREAVARSGIWKEEIAGRF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003232`
TK1151 ID	TkA01G383760
OH-1004 ID	LXL04_003232
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.133 / OH-1004 75.885 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003232

Location Chr01:71506364-71510016 (+)

Description Similar to KLCR1: Protein KINESIN LIGHT CHAIN-RELATED 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10840`	Protein KINESIN LIGHT CHAIN-RELATED 1.	No verified direct reference in this release
`At3g28410`	Putative F-box/LRR-repeat protein At3g28410.	No verified direct reference in this release
`At1g27500`	Protein KINESIN LIGHT CHAIN-RELATED 3.	No verified direct reference in this release
`At5g02700`	Putative F-box/LRR-repeat protein At5g02700.	No verified direct reference in this release
`At5g03100`	F-box protein At5g03100.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003232 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

KEGG gene cross-reference

ath:AT1G27500

ath:AT3G28410

ath:AT4G10840

ath:AT5G02700

ath:AT5G03100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.624

Rank 1 · LXL04_003232 · OH-1004

Cytoplasm0.344

Rank 2 · LXL04_003232 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_003232 · OH-1004

Endoplasmic reticulum0.071

Rank 4 · LXL04_003232 · OH-1004

Mitochondrion0.036

Rank 5 · LXL04_003232 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box39-78 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003232	`PF00646.39`	F-box	39	78	6.6e-07	29.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81629`	Arabidopsis thaliana	Protein KINESIN LIGHT CHAIN-RELATED 1	67.123%	Swiss-Prot	weak database homology
`Q9LSJ3`	Arabidopsis thaliana	Putative F-box/LRR-repeat protein At3g28410	28.968%	Swiss-Prot	weak database homology
`F4HSX9`	Arabidopsis thaliana	Protein KINESIN LIGHT CHAIN-RELATED 3	58.065%	Swiss-Prot	weak database homology
`Q9LZ15`	Arabidopsis thaliana	Putative F-box/LRR-repeat protein At5g02700	28.175%	Swiss-Prot	weak database homology
`Q501G5`	Arabidopsis thaliana	F-box protein At5g03100	30.732%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card