LXL04_003205 | RubberDandelionOmics

Gene overview

LXL04_003205

Reference: OH-1004 Chr: Chr01 Coordinates: 70855714-70859011 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

936 bp · LXL04_003205|LXL04_003205|OH1004|cDNA

ATGCTGTGTGCAAGCAGCAACTTGTGTTTGAATTCGTACCTGGCTGCAACTCATGAAGCACGCGGCAAGTGCATAGTGAGGGTGAGAGCGAACATCCGAGTCGAGATGGAGATCGGTGGGTTAGATAGCAATGGCCGGGAATTCAAGAACGCCGATGAAATGTGGCGAGAAGAAGTTGGTGATTCACAGAAGAAGCTCGATTGGTACCGCAACGGCGTTGGCTACTGGCAAGGCGTGGATGCGTCAGTTGATGGAGTTCT...

CDS

Download CDS FASTA

936 bp · LXL04_003205|LXL04_003205|OH1004|CDS

ATGCTGTGTGCAAGCAGCAACTTGTGTTTGAATTCGTACCTGGCTGCAACTCATGAAGCACGCGGCAAGTGCATAGTGAGGGTGAGAGCGAACATCCGAGTCGAGATGGAGATCGGTGGGTTAGATAGCAATGGCCGGGAATTCAAGAACGCCGATGAAATGTGGCGAGAAGAAGTTGGTGATTCACAGAAGAAGCTCGATTGGTACCGCAACGGCGTTGGCTACTGGCAAGGCGTGGATGCGTCAGTTGATGGAGTTCT...

Protein

Download Protein FASTA

311 aa · LXL04_003205|LXL04_003205|OH1004|PROTEIN

MLCASSNLCLNSYLAATHEARGKCIVRVRANIRVEMEIGGLDSNGREFKNADEMWREEVGDSQKKLDWYRNGVGYWQGVDASVDGVLGGYGHVNEPDIKSSEAFLNTLLNELIPNAGRNRHLVALDCGSGIGRVTKNLLIRYFNEVDLLEPVSHFLEAARENLAPENLSVSEEHKAANFYCTPLQEFTPDAGRYDVIWIQWCIGHLADDDFVSFFKRAKAGLKPGGFFVLKENLARSGFVLDKEDKSLTRSDVYFKELFT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003205`
TK1151 ID	TkA01G385800
OH-1004 ID	LXL04_003205
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003205

Location Chr01:70855714-70859011 (-)

Description Similar to At5g44450: Alpha N-terminal protein methyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44450`	Alpha-N-methyltransferase that methylates the N-terminus of target proteins containing the N-terminal motif [Ala/Pro/Ser]-Pro-Lys when the initiator Met is cleaved.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XMJ1`	Alpha-N-methyltransferase that methylates the N-terminus of target proteins containing the N-terminal motif [Ala/Pro/Ser]-Pro-Lys when the initiator Met is cleaved.	No verified direct reference in this release
`Os03g0780900`	Alpha-N-methyltransferase that methylates the N-terminus of target proteins containing the N-terminal motif [Ala/Pro/Ser]-Pro-Lys when the initiator Met is cleaved.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003205 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007051 spindle organization Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0018013 N-terminal peptidyl-glycine methylation Biological Process

GO:0018016 N-terminal peptidyl-proline dimethylation Biological Process

GO:0032259 methylation Biological Process

GO:0035572 N-terminal peptidyl-serine dimethylation Biological Process

GO:0035573 N-terminal peptidyl-serine trimethylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008168 methyltransferase activity Molecular Function

GO:0008276 protein methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT5G44450

dosa:Os03g0780900

xla:734671

xtr:100145456

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.432

Rank 1 · LXL04_003205 · OH-1004

Cytoplasm0.233

Rank 2 · LXL04_003205 · OH-1004

Nucleus0.231

Rank 3 · LXL04_003205 · OH-1004

Mitochondrion0.091

Rank 4 · LXL04_003205 · OH-1004

Peroxisome0.065

Rank 5 · LXL04_003205 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05891.19Methyltransf_PK66-288 aa

PF13489.13Methyltransf_23108-243 aa

PF13649.13Methyltransf_25125-226 aa

PF08241.19Methyltransf_11125-230 aa

PF08242.19Methyltransf_12125-228 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003205	`PF05891.19`	Methyltransf_PK	66	288	9.6e-95	316.9
LXL04_003205	`PF13489.13`	Methyltransf_23	108	243	8.1e-07	29.6
LXL04_003205	`PF13649.13`	Methyltransf_25	125	226	2.6e-11	44.8
LXL04_003205	`PF08241.19`	Methyltransf_11	125	230	1.6e-09	38.9
LXL04_003205	`PF08242.19`	Methyltransf_12	125	228	3.8e-07	31.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5PP70`	Arabidopsis thaliana	Alpha N-terminal protein methyltransferase 1	70.968%	Swiss-Prot	strong database homology
`A2XMJ1`	Oryza sativa subsp. indica	Alpha N-terminal protein methyltransferase 1	58.576%	Swiss-Prot	strong database homology
`Q10CT5`	Oryza sativa subsp. japonica	Alpha N-terminal protein methyltransferase 1	58.252%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card