LXL04_003203 | RubberDandelionOmics

Gene overview

LXL04_003203

Reference: OH-1004 Chr: Chr01 Coordinates: 70838269-70841330 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

640 bp · LXL04_003203|LXL04_003203|OH1004|cDNA

ATGGCGTACGCGGTGTTGAAGAGATCTTCCATGATGAAGTCAATGACCACGGGAATCGGGGAATCATGGCGGAGGTTTGCTTCCGTTGCAGTAGGGAGCGATCTTGTAGCAGCCGCTCCTAATGTTTCTCTCCAGAAGGCTCGGACATGGGATGAAGGCGTCTCCTCCCAATTCTCCACCACTCCTCTCTCTGACATTTTCAAGGGCAAAAAGGTCGTCATCTTTGGGCTTCCTGGTGCATTCACAGGAGTTTGTACAGC...

CDS

Download CDS FASTA

621 bp · LXL04_003203|LXL04_003203|OH1004|CDS

ATGGCGTACGCGGTGTTGAAGAGATCTTCCATGATGAAGTCAATGACCACGGGAATCGGGGAATCATGGCGGAGGTTTGCTTCCGTTGCAGTAGGGAGCGATCTTGTAGCAGCCGCTCCTAATGTTTCTCTCCAGAAGGCTCGGACATGGGATGAAGGCGTCTCCTCCCAATTCTCCACCACTCCTCTCTCTGACATTTTCAAGGGCAAAAAGGTCGTCATCTTTGGGCTTCCTGGTGCATTCACAGGAGTTTGTACAGC...

Protein

Download Protein FASTA

206 aa · LXL04_003203|LXL04_003203|OH1004|PROTEIN

MAYAVLKRSSMMKSMTTGIGESWRRFASVAVGSDLVAAAPNVSLQKARTWDEGVSSQFSTTPLSDIFKGKKVVIFGLPGAFTGVCTAQHVPSYKKNIDKFKAKGVDSVICVSVNDPYTMNGWADKLEAKEAIEFYGDFDGKFHKSLDLELDLSAALLGHRSTRWSAFVEDGKVKVLNVENVPSEFKVSGGEKEDEEIQVSVTAECL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003203`
TK1151 ID	TkA01G385830
OH-1004 ID	LXL04_003203
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 95.814 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003203

Location Chr01:70838269-70841330 (+)

Description Similar to PRXIIF: Peroxiredoxin-2F, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06050`	Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively.	No verified direct reference in this release
`At1g60740`	Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively.	No verified direct reference in this release
`At1g65980`	Reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin or glutaredoxin system.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0266600`	Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively.	No verified direct reference in this release
`Os01g0675100`	Reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin or glutaredoxin system.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003203 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0045454 cell redox homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004601 peroxidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G60740

ath:AT1G65980

ath:AT3G06050

dosa:Os01g0266600

dosa:Os01g0675100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.890

Rank 1 · LXL04_003203 · OH-1004

Cytoplasm0.119

Rank 2 · LXL04_003203 · OH-1004

Nucleus0.063

Rank 3 · LXL04_003203 · OH-1004

Plastid0.044

Rank 4 · LXL04_003203 · OH-1004

Extracellular0.022

Rank 5 · LXL04_003203 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00578.28AhpC-TSA38-151 aa

PF08534.17Redoxin39-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003203	`PF00578.28`	AhpC-TSA	38	151	5.7e-13	49.6
LXL04_003203	`PF08534.17`	Redoxin	39	188	1.3e-26	93.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M7T0`	Arabidopsis thaliana	Peroxiredoxin-2F, mitochondrial	71.282%	Swiss-Prot	strong database homology
`O22711`	Arabidopsis thaliana	Peroxiredoxin-2D	41.549%	Swiss-Prot	moderate database homology
`Q9XEX2`	Arabidopsis thaliana	Peroxiredoxin-2B	40.845%	Swiss-Prot	moderate database homology
`Q9SDD6`	Oryza sativa subsp. japonica	Peroxiredoxin-2F, mitochondrial	71.354%	Swiss-Prot	strong database homology
`Q9FR35`	Oryza sativa subsp. japonica	Peroxiredoxin-2C	40.120%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card