LXL04_002844 | RubberDandelionOmics

Gene overview

LXL04_002844

Reference: OH-1004 Chr: Chr01 Coordinates: 59474448-59478052 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1083 bp · LXL04_002844|LXL04_002844|OH1004|cDNA

ATGGCCGCCATCTCAAGTCCGATTCTGATAACTGAGAACTCGCGTCTATGGTCAAGAAGGTTGCTGACTTCACATGCTTCAACAAGAATTAGCAACAACGGTGTTGCAGCGGTGGTGCCAAGTGTTTTCCGACGTGGTTCCTCTTCTATTAATGCGAAGGGCATGCAGAGGGAAGAAGGCGAACGCAGATTTCCACGGCAGAAGCAGGACGGTCAACCTGGAAAAGAATACCTCATGGATCCTCTCCCAATATTCAGCGA...

CDS

Download CDS FASTA

1083 bp · LXL04_002844|LXL04_002844|OH1004|CDS

ATGGCCGCCATCTCAAGTCCGATTCTGATAACTGAGAACTCGCGTCTATGGTCAAGAAGGTTGCTGACTTCACATGCTTCAACAAGAATTAGCAACAACGGTGTTGCAGCGGTGGTGCCAAGTGTTTTCCGACGTGGTTCCTCTTCTATTAATGCGAAGGGCATGCAGAGGGAAGAAGGCGAACGCAGATTTCCACGGCAGAAGCAGGACGGTCAACCTGGAAAAGAATACCTCATGGATCCTCTCCCAATATTCAGCGA...

Protein

Download Protein FASTA

360 aa · LXL04_002844|LXL04_002844|OH1004|PROTEIN

MAAISSPILITENSRLWSRRLLTSHASTRISNNGVAAVVPSVFRRGSSSINAKGMQREEGERRFPRQKQDGQPGKEYLMDPLPIFSDPHYQPTNKLKGKVALVTGGDSGIGRSVCYFYAKEGATVAFTYVKGVEDIDAKNTLKIINDAKVRDAGAPIAIPADLRYDKNCKKVVDEVVAKYGRIDILVNNVAIQYNTYTLDDVTEERLERVFRTNIFSYFFVTRHAVKHMKAESSIINTTSVLGFSGRAKYIDYASTKGAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002844`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002844

Location Chr01:59474448-59478052 (+)

Description Similar to CAISE5: Glucose and ribitol dehydrogenase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54870`	Aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons.	NADPH-dependent reductases involved in the detoxification of reactive carbonyls in plants.2011 · DOI: 10.1074/jbc.m110.202226
`At3g05260`	May act as a short alcohol-polyol-sugar dehydrogenase possibly related to carbohydrate metabolism and the acquisition of desiccation tolerance.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0140800`	May act as a short alcohol-polyol-sugar dehydrogenase possibly related to carbohydrate metabolism and the acquisition of desiccation tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002844 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0008206 bile acid metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

GO:0016614 oxidoreductase activity, acting on CH-OH group of donors Molecular Function

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

KEGG gene cross-reference

ath:AT1G54870

ath:AT3G05260

bsu:BSU09450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.833

Rank 1 · LXL04_002844 · OH-1004

Mitochondrion0.194

Rank 2 · LXL04_002844 · OH-1004

Cytoplasm0.028

Rank 3 · LXL04_002844 · OH-1004

Nucleus0.022

Rank 4 · LXL04_002844 · OH-1004

Peroxisome0.014

Rank 5 · LXL04_002844 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106.32adh_short99-297 aa

PF13561.13adh_short_C2107-343 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002844	`PF00106.32`	adh_short	99	297	5.6e-45	153.9
LXL04_002844	`PF13561.13`	adh_short_C2	107	343	1.6e-53	182.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FZ42`	Arabidopsis thaliana	NADPH-dependent aldehyde reductase 1, chloroplastic	62.366%	Swiss-Prot	strong database homology
`Q9MA93`	Arabidopsis thaliana	Glucose and ribitol dehydrogenase homolog 2	58.007%	Swiss-Prot	strong database homology
`Q75KH3`	Oryza sativa subsp. japonica	Glucose and ribitol dehydrogenase homolog	57.877%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card