LXL04_002704 | RubberDandelionOmics

Gene overview

LXL04_002704

Reference: OH-1004 Chr: Chr01 Coordinates: 55473298-55475507 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1296 bp · LXL04_002704|LXL04_002704|OH1004|cDNA

ATGTCGTCGAACGTGGTGGTGGTTCTCGACAACGGCGGCGGTCTAATTAAGGCAGGCATCGGCGGTGAGCGTGATCCAACAACCGTAGTCCCAAACTGCACTGCTCGTCCGCTTTCCTCCAAGAAATTCCTACTAGCGGACCAACTTCTGTCTCAAACGGAAGACCTAACCTCGGCCGTTCTCCGCCGTCCCTTCGACCGCGGTTACCTCATCAACCAAGACCTCCAATCAACCATCTGGTCACACatcttctcttctct...

CDS

Download CDS FASTA

1296 bp · LXL04_002704|LXL04_002704|OH1004|CDS

ATGTCGTCGAACGTGGTGGTGGTTCTCGACAACGGCGGCGGTCTAATTAAGGCAGGCATCGGCGGTGAGCGTGATCCAACAACCGTAGTCCCAAACTGCACTGCTCGTCCGCTTTCCTCCAAGAAATTCCTACTAGCGGACCAACTTCTGTCTCAAACGGAAGACCTAACCTCGGCCGTTCTCCGCCGTCCCTTCGACCGCGGTTACCTCATCAACCAAGACCTCCAATCAACCATCTGGTCACACATCTTCTCTTCTCT...

Protein

Download Protein FASTA

431 aa · LXL04_002704|LXL04_002704|OH1004|PROTEIN

MSSNVVVVLDNGGGLIKAGIGGERDPTTVVPNCTARPLSSKKFLLADQLLSQTEDLTSAVLRRPFDRGYLINQDLQSTIWSHIFSSLLHVTPSSSSLLLTEPLFNLPSIQRATDEIVFEEFNFKSLFVSDSPSLVHLYEASRRPYDVVSKAQCSLVVDVGFSFTHVAPVFQNFTVNYGVKRMDLGGKALTNYLKELVSYRSINVMDETFLIDDVKEKLCFVSTDVARDLQIARRRGNDNYFRCTYVLPDGITHTKGFVKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002704`
TK1151 ID	TkA01G426950
OH-1004 ID	LXL04_002704
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002704

Location Chr01:55473298-55475507 (-)

Description Similar to ARP6: Actin-related protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g33520`	Component of the SWR1 complex which mediates the ATP- dependent exchange of histone H2A for the H2A variant H2A.F/Z leading to transcriptional regulation of selected genes (e.g. FLC) by chromatin remodeling.	The nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis.2005 · DOI: 10.1105/tpc.105.035196 SUPPRESSOR OF FRIGIDA3 encodes a nuclear ACTIN-RELATED PROTEIN6 required for floral repression in Arabidopsis.2005 · DOI: 10.1105/tpc.105.035485 EARLY IN SHORT DAYS 1 (ESD1) encodes ACTIN-RELATED PROTEIN 6 (AtARP6), a putative component of chromatin remodelling complexes that positively regulates FLC accumulation in Arabidopsis.2006 · DOI: 10.1242/dev.02301 Repression of flowering in Arabidopsis requires activation of FLOWERING LOCUS C expression by the histone variant H2A.Z.2007 · DOI: 10.1105/tpc.106.048447 Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development.2007 · DOI: 10.1242/dev.001891 Histone H2A.Z and homologues of components of the SWR1 complex are required to control immunity in Arabidopsis.2008 · DOI: 10.1111/j.1365-313x.2007.03361.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0269900`	Component of the SWR1 complex which mediates the ATP-dependent exchange of histone H2A for the H2A variant H2A.F/Z leading to transcriptional regulation of selected genes by chromatin remodeling.	No verified direct reference in this release
`UniProt: A2WNB0`	Component of the SWR1 complex which mediates the ATP-dependent exchange of histone H2A for the H2A variant H2A.F/Z leading to transcriptional regulation of selected genes by chromatin remodeling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002704 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0007000 nucleolus organization Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009845 seed germination Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0016479 negative regulation of transcription by RNA polymerase I Biological Process

GO:0030029 actin filament-based process Biological Process

KEGG gene cross-reference

ath:AT3G33520

dosa:Os01g0269900

hsa:64431

mmu:67019

osa:4326270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.650

Rank 1 · LXL04_002704 · OH-1004

Cytoplasm0.509

Rank 2 · LXL04_002704 · OH-1004

Mitochondrion0.060

Rank 3 · LXL04_002704 · OH-1004

Cell membrane0.026

Rank 4 · LXL04_002704 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_002704 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00022.27Actin5-430 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002704	`PF00022.27`	Actin	5	430	5e-97	325.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LGE3`	Arabidopsis thaliana	Actin-related protein 6	70.561%	Swiss-Prot	strong database homology
`Q5NBI2`	Oryza sativa subsp. japonica	Actin-related protein 6	68.310%	Swiss-Prot	strong database homology
`A2WNB0`	Oryza sativa subsp. indica	Actin-related protein 6	68.310%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card