LXL04_002557 | RubberDandelionOmics

Gene overview

LXL04_002557

Reference: OH-1004 Chr: Chr01 Coordinates: 51478368-51479234 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

480 bp · LXL04_002557|LXL04_002557|OH1004|cDNA

ATGATATCAACCATAACTCAAGAGATTTATACCGAGAAGAGAAAAGAACAAGATATTTCAAAAGCTAATTGTGTGAAAGAATTCATCGGAAAGAATTCATCGGAAGATGGGCTTTTGAATGTGGGATTCCTTTTCATACATTTGAAATGGATATTTTTAAAGTCGCTTTGGATGCGGTTAGGCAATCTGGATGTGCGGTTATCAAAATCGCTTGATTTCCTAGGTGGTGTAGCGGTAGTCGTTCATGAAGTCAAGAGTAT...

CDS

Download CDS FASTA

480 bp · LXL04_002557|LXL04_002557|OH1004|CDS

ATGATATCAACCATAACTCAAGAGATTTATACCGAGAAGAGAAAAGAACAAGATATTTCAAAAGCTAATTGTGTGAAAGAATTCATCGGAAAGAATTCATCGGAAGATGGGCTTTTGAATGTGGGATTCCTTTTCATACATTTGAAATGGATATTTTTAAAGTCGCTTTGGATGCGGTTAGGCAATCTGGATGTGCGGTTATCAAAATCGCTTGATTTCCTAGGTGGTGTAGCGGTAGTCGTTCATGAAGTCAAGAGTAT...

Protein

Download Protein FASTA

159 aa · LXL04_002557|LXL04_002557|OH1004|PROTEIN

MISTITQEIYTEKRKEQDISKANCVKEFIGKNSSEDGLLNVGFLFIHLKWIFLKSLWMRLGNLDVRLSKSLDFLGGVAVVVHEVKSISPIFFDTMKLLGLKPNMVTYNALINGFQLDRITYNFLLAVCTGGGLWETAMNLFHEMSYKGIDVLDCITKFT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002557`
TK1151 ID	TkA01G320510
OH-1004 ID	LXL04_002557
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	57.100
Protein coverage (%)	TK1151 50.588 / OH-1004 52.201 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002557

Location Chr01:51478368-51479234 (-)

Description Similar to At2g31400: Pentatricopeptide repeat-containing protein At2g31400, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31400`	Involved in nuclear gene expression via the retrograde plastid-to-nucleus signaling.	Signals from chloroplasts converge to regulate nuclear gene expression.2007 · PMID: 17395793 Plastid signals that affect photomorphogenesis in Arabidopsis thaliana are dependent on GENOMES UNCOUPLED 1 and cryptochrome 1.2009 · DOI: 10.1111/j.1469-8137.2008.02729.x The Arabidopsis plastid-signalling mutant gun1 (genomes uncoupled1) shows altered sensitivity to sucrose and abscisic acid and alterations in early seedling development.2010 · DOI: 10.1093/jxb/erq186 Timing the switch to phototrophic growth: a possible role of GUN1.2011 · DOI: 10.4161/psb.6.4.14900
`At1g10910`	Pentatricopeptide repeat-containing protein At1g10910, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002557 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:1900865 chloroplast RNA modification Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G10910

ath:AT2G31400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.349

Rank 1 · LXL04_002557 · OH-1004

Cytoplasm0.191

Rank 2 · LXL04_002557 · OH-1004

Nucleus0.160

Rank 3 · LXL04_002557 · OH-1004

Plastid0.116

Rank 4 · LXL04_002557 · OH-1004

Endoplasmic reticulum0.060

Rank 5 · LXL04_002557 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13812.13PPR_385-112 aa

PF13041.13PPR_291-114 aa

PF12854.14PPR_199-114 aa

PF13041.13PPR_2117-150 aa

PF01535.27PPR119-149 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002557	`PF13812.13`	PPR_3	85	112	1.4e-08	35.4
LXL04_002557	`PF13041.13`	PPR_2	91	114	9e-13	48.8
LXL04_002557	`PF12854.14`	PPR_1	99	114	1.8e-09	37.9
LXL04_002557	`PF13041.13`	PPR_2	117	150	9e-13	48.8
LXL04_002557	`PF01535.27`	PPR	119	149	7.6e-07	29.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIC9`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein GUN1, chloroplastic	43.750%	Swiss-Prot	weak database homology
`Q0WVV0`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g10910, chloroplastic	33.750%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card