LXL04_002454 | RubberDandelionOmics

Gene overview

LXL04_002454

Reference: OH-1004 Chr: Chr01 Coordinates: 49127442-49129530 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

852 bp · LXL04_002454|LXL04_002454|OH1004|cDNA

ATGCCAGCAGGCGAACCCCGACGCCCGGATGCGGCGGACGAGGCACAGTGGGTATGGGCTGAGATCAAGGCGGAGGCTCGCCGTGACGCCGAGTCGGAGCCGGCGTTGGCTAGCTACTTATACTCCACCATAATCTCTCACTCCACTTTGGATCGGTCTCTCTCGTTCCACCTTGGAAATAAGCTTTGCTCCTCCACGTTGCTGTCAACTCTGCTGTACGATCTCTTCCTGAACGCGTTCTCCGGCGACCCAGACCTCCA...

CDS

Download CDS FASTA

852 bp · LXL04_002454|LXL04_002454|OH1004|CDS

ATGCCAGCAGGCGAACCCCGACGCCCGGATGCGGCGGACGAGGCACAGTGGGTATGGGCTGAGATCAAGGCGGAGGCTCGCCGTGACGCCGAGTCGGAGCCGGCGTTGGCTAGCTACTTATACTCCACCATAATCTCTCACTCCACTTTGGATCGGTCTCTCTCGTTCCACCTTGGAAATAAGCTTTGCTCCTCCACGTTGCTGTCAACTCTGCTGTACGATCTCTTCCTGAACGCGTTCTCCGGCGACCCAGACCTCCA...

Protein

Download Protein FASTA

283 aa · LXL04_002454|LXL04_002454|OH1004|PROTEIN

MPAGEPRRPDAADEAQWVWAEIKAEARRDAESEPALASYLYSTIISHSTLDRSLSFHLGNKLCSSTLLSTLLYDLFLNAFSGDPDLQSAAVADLRATRTRDPACVSFSHCLLNYKGFLACQAHRVAHKLWTQSRRPLALALQSRISDVFAVDIHPGAKLGKGILFDHATGVVVGETAVIGDNVSLLHHVTLGGTGKAGGDRHPKIGDGVLIGAGATILGNVKIGAGANIGAGSVVLIEVPPRATAVGNPARVVEGKEASK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002454`
TK1151 ID	TkA01G457610
OH-1004 ID	LXL04_002454
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002454

Location Chr01:49127442-49129530 (+)

Description Similar to SAT5: Serine acetyltransferase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56760`	Serine acetyltransferase 5.	No verified direct reference in this release
`At3g13110`	Serine acetyltransferase 3, mitochondrial.	No verified direct reference in this release
`At1g55920`	Serine acetyltransferase which catalyzes the formation of O-acetyl-L-serine from acetyl-CoA and L-serine.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0533500`	Probable serine acetyltransferase 5.	No verified direct reference in this release
`Os01g0720700`	Probable serine acetyltransferase 1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002454 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006535 L-cysteine biosynthetic process from L-serine Biological Process

GO:0009970 cellular response to sulfate starvation Biological Process

GO:0019344 L-cysteine biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0009001 serine O-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G55920

ath:AT3G13110

ath:AT5G56760

dosa:Os01g0720700

dosa:Os05g0533500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.430

Rank 1 · LXL04_002454 · OH-1004

Nucleus0.250

Rank 2 · LXL04_002454 · OH-1004

Mitochondrion0.195

Rank 3 · LXL04_002454 · OH-1004

Plastid0.121

Rank 4 · LXL04_002454 · OH-1004

Peroxisome0.084

Rank 5 · LXL04_002454 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06426.20SATase_N18-122 aa

PF00132.31Hexapep202-235 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002454	`PF06426.20`	SATase_N	18	122	7e-36	123.4
LXL04_002454	`PF00132.31`	Hexapep	202	235	2.9e-14	52.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42538`	Arabidopsis thaliana	Serine acetyltransferase 5	83.209%	Swiss-Prot	strong database homology
`Q39218`	Arabidopsis thaliana	Serine acetyltransferase 3, mitochondrial	58.545%	Swiss-Prot	strong database homology
`Q42588`	Arabidopsis thaliana	Serine acetyltransferase 1, chloroplastic	58.052%	Swiss-Prot	strong database homology
`Q0DGG8`	Oryza sativa subsp. japonica	Probable serine acetyltransferase 5	74.737%	Swiss-Prot	strong database homology
`Q8W0E4`	Oryza sativa subsp. japonica	Probable serine acetyltransferase 1	76.471%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card