LXL04_002409 | RubberDandelionOmics

Gene overview

LXL04_002409

Reference: OH-1004 Chr: Chr01 Coordinates: 48021140-48026313 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2802 bp · LXL04_002409|LXL04_002409|OH1004|cDNA

ATGGTTCCTGATTCTTTTTTACAAATTGCTAAAAAAAGGGCGAGAGTGATTCCTGAAGATCCGATGATGGATACACGAACAGGCTTCTCTGATTCAACCGATATAATAAGCGGAAGCAGCGGTGTATCAAGTGCACCCGCCAACACTGAATTTGAACCTCCCCTTCTTCTTTCCGACGTTTCCGCCCTCGATCGTCTATCGGAAACCCTAGAATCTCTCTTACTAGAACCCGCAAATTCATTCGCTGACGCCAAAATTAT...

CDS

Download CDS FASTA

2802 bp · LXL04_002409|LXL04_002409|OH1004|CDS

ATGGTTCCTGATTCTTTTTTACAAATTGCTAAAAAAAGGGCGAGAGTGATTCCTGAAGATCCGATGATGGATACACGAACAGGCTTCTCTGATTCAACCGATATAATAAGCGGAAGCAGCGGTGTATCAAGTGCACCCGCCAACACTGAATTTGAACCTCCCCTTCTTCTTTCCGACGTTTCCGCCCTCGATCGTCTATCGGAAACCCTAGAATCTCTCTTACTAGAACCCGCAAATTCATTCGCTGACGCCAAAATTAT...

Protein

Download Protein FASTA

933 aa · LXL04_002409|LXL04_002409|OH1004|PROTEIN

MVPDSFLQIAKKRARVIPEDPMMDTRTGFSDSTDIISGSSGVSSAPANTEFEPPLLLSDVSALDRLSETLESLLLEPANSFADAKIILSGGREIPVHRCILSGRSPFFKNKFGDSTNKDRNRNVKLQMKEIASDYEIGFESLISVLKYMYSGKINGLPKDACTCVDEECSHEACRPAIDFMVEVMYAFHIFQIPEMVALWQTRIHNILDKASADDILLIVSVANTCGKSSEQLLSKSIDILVNSNVDFVTLDKALPEQIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002409`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002409

Location Chr01:48021140-48026313 (+)

Description Similar to NPR1: BTB/POZ domain and ankyrin repeat-containing protein NPR1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64280`	Salicylic acid (SA)-binding substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance.1995 · DOI: 10.1073/pnas.92.14.6602 NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol.2003 · DOI: 10.1105/tpc.009159 Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis.2003 · DOI: 10.1105/tpc.012211 The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcription factor TGA1.2003 · DOI: 10.1105/tpc.012849 NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants.2012 · DOI: 10.1038/nature11162 Structural basis of salicylic acid perception by Arabidopsis NPR proteins.2020 · DOI: 10.1038/s41586-020-2596-y Structural basis of NPR1 in activating plant immunity.2022 · DOI: 10.1038/s41586-022-04699-w Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene.1997 · DOI: 10.1094/mpmi.1997.10.1.69 The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats.1997 · DOI: 10.1016/s0092-8674(00)81858-9
`At4g26120`	Salicylic acid (SA)-binding substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0194300`	Salicylic acid (SA)-binding substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	Functional analysis of rice NPR1-like genes reveals that OsNPR1/NH1 is the rice orthologue conferring disease resistance with enhanced herbivore susceptibility.2007 · DOI: 10.1111/j.1467-7652.2007.00243.x Role of OsNPR1 in rice defense program as revealed by genome-wide expression analysis.2010 · DOI: 10.1007/s11103-010-9695-3 A rice transient assay system identifies a novel domain in NRR required for interaction with NH1/OsNPR1 and inhibition of NH1-mediated transcriptional activation.2012 · DOI: 10.1186/1746-4811-8-6 OsNPR1 negatively regulates herbivore-induced JA and ethylene signaling and plant resistance to a chewing herbivore in rice.2013 · DOI: 10.1111/j.1399-3054.2012.01666.x
`UniProt: Q5D0W8`	Salicylic acid (SA)-binding substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002409 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009408 response to heat Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009625 response to insect Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009682 induced systemic resistance Biological Process

KEGG gene cross-reference

ath:AT1G64280

ath:AT4G26120

dosa:Os01g0194300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.766

Rank 1 · LXL04_002409 · OH-1004

Cytoplasm0.247

Rank 2 · LXL04_002409 · OH-1004

Cell membrane0.043

Rank 3 · LXL04_002409 · OH-1004

Mitochondrion0.033

Rank 4 · LXL04_002409 · OH-1004

Endoplasmic reticulum0.023

Rank 5 · LXL04_002409 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651.38BTB79-155 aa

PF11900.15DUF3420245-289 aa

PF12796.14Ank_2289-373 aa

PF12313.14NPR1_like_C388-542 aa

PF03101.22FAR1639-724 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002409	`PF00651.38`	BTB	79	155	3.9e-10	40.6
LXL04_002409	`PF11900.15`	DUF3420	245	289	8e-08	33.0
LXL04_002409	`PF12796.14`	Ank_2	289	373	1.8e-07	32.3
LXL04_002409	`PF12313.14`	NPR1_like_C	388	542	9e-68	228.6
LXL04_002409	`PF03101.22`	FAR1	639	724	5.1e-14	53.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93002`	Arabidopsis thaliana	Regulatory protein NPR1	50.568%	Swiss-Prot	moderate database homology
`Q9SZI3`	Arabidopsis thaliana	Regulatory protein NPR2	47.203%	Swiss-Prot	moderate database homology
`Q9FDY4`	Oryza sativa subsp. japonica	BTB/POZ domain and ankyrin repeat-containing protein NPR1	52.583%	Swiss-Prot	moderate database homology
`Q5D0W8`	Oryza sativa subsp. indica	BTB/POZ domain and ankyrin repeat-containing protein NPR1	55.020%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card