LXL04_002358 | RubberDandelionOmics

Gene overview

LXL04_002358

Reference: OH-1004 Chr: Chr01 Coordinates: 46911046-46913422 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

924 bp · LXL04_002358|LXL04_002358|OH1004|cDNA

ATGGTGTCGTATATGAGCTTGGTGATGTATGGAGTGGGCGGAATAGTGGTGGCCGGAATGGCATTATTGGTGGCGTTTCAGGAAAAATTAGTCTACGTGCCGGTTTTGCCTGGTCTGACCAAGTCCTATCCAATCACACCAGCTCGACTACGCATGATTTACGAAGACGTATGGCTTACTTCTTCCGATGGTATACGCCTTCACTCCTGGTTCATCAAGTTCTCTCCAGATTGCACAGGCCCAACTATTCTATTCTTCCA...

CDS

Download CDS FASTA

924 bp · LXL04_002358|LXL04_002358|OH1004|CDS

ATGGTGTCGTATATGAGCTTGGTGATGTATGGAGTGGGCGGAATAGTGGTGGCCGGAATGGCATTATTGGTGGCGTTTCAGGAAAAATTAGTCTACGTGCCGGTTTTGCCTGGTCTGACCAAGTCCTATCCAATCACACCAGCTCGACTACGCATGATTTACGAAGACGTATGGCTTACTTCTTCCGATGGTATACGCCTTCACTCCTGGTTCATCAAGTTCTCTCCAGATTGCACAGGCCCAACTATTCTATTCTTCCA...

Protein

Download Protein FASTA

307 aa · LXL04_002358|LXL04_002358|OH1004|PROTEIN

MVSYMSLVMYGVGGIVVAGMALLVAFQEKLVYVPVLPGLTKSYPITPARLRMIYEDVWLTSSDGIRLHSWFIKFSPDCTGPTILFFQENAGNIAHRLEMVRIMLQKLQCNIFMLSYRGYGASDGYPSQQGITRDAQAALDHLSQRTDIDTSQIVVFGRSLGGAVGVVVTKNNPDKVAALILENTFTSILDMAGVLLPFLKWFIGGSISKGPKILNFVVRSPWNTLDVVGQVKQPVLFLSGLRDEMVPPVHMQMLYAKTAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002358`
TK1151 ID	TkA01G452610
OH-1004 ID	LXL04_002358
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002358

Location Chr01:46911046-46913422 (+)

Description Similar to WAV2: Alpha/beta hydrolase domain-containing protein WAV2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20520`	Involved in the regulation of root growth.	The Arabidopsis WAVY GROWTH 2 protein modulates root bending in response to environmental stimuli.2005 · DOI: 10.1105/tpc.104.028530

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002358 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002084 protein depalmitoylation Biological Process

GO:0006508 proteolysis Biological Process

GO:0048364 root development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0019866 organelle inner membrane Cellular Component

GO:0008236 serine-type peptidase activity Molecular Function

GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT5G20520

dre:561333

mmu:68904

spo:2540264

xla:432053

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.560

Rank 1 · LXL04_002358 · OH-1004

Mitochondrion0.171

Rank 2 · LXL04_002358 · OH-1004

Cytoplasm0.167

Rank 3 · LXL04_002358 · OH-1004

Nucleus0.104

Rank 4 · LXL04_002358 · OH-1004

Cell membrane0.096

Rank 5 · LXL04_002358 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146.16Hydrolase_4104-195 aa

PF00561.27Abhydrolase_1104-205 aa

PF00326.28Peptidase_S9132-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002358	`PF12146.16`	Hydrolase_4	104	195	7.2e-13	49.1
LXL04_002358	`PF00561.27`	Abhydrolase_1	104	205	1.2e-12	48.7
LXL04_002358	`PF00326.28`	Peptidase_S9	132	296	3.1e-13	50.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXP6`	Arabidopsis thaliana	Alpha/beta hydrolase domain-containing protein WAV2	78.808%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card