LXL04_002213 | RubberDandelionOmics

Gene overview

LXL04_002213

Reference: OH-1004 Chr: Chr01 Coordinates: 43840120-43845856 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3117 bp · LXL04_002213|LXL04_002213|OH1004|cDNA

ATGGGTGAGGATCCAGTGAATCTGAATGAGTATCAAGAATTGGCAAGACAGGCCCTTCCAAAAATGTATTACGACTACTTTTCTGGAGGATCCGAGGATCAACACACGCTAAGAGAGAATGTTGAAGCATTTAAACGAATCACTCTTCGACCAAGAATTCTTGTGGATGTGAGCAAAATAGATATGTCGACAACAATTTTGGGTTACAAAACTTCAGCACCCATTATGATCGCCCCAACCGCTATGCATAAGTTAGCACA...

CDS

Download CDS FASTA

3117 bp · LXL04_002213|LXL04_002213|OH1004|CDS

ATGGGTGAGGATCCAGTGAATCTGAATGAGTATCAAGAATTGGCAAGACAGGCCCTTCCAAAAATGTATTACGACTACTTTTCTGGAGGATCCGAGGATCAACACACGCTAAGAGAGAATGTTGAAGCATTTAAACGAATCACTCTTCGACCAAGAATTCTTGTGGATGTGAGCAAAATAGATATGTCGACAACAATTTTGGGTTACAAAACTTCAGCACCCATTATGATCGCCCCAACCGCTATGCATAAGTTAGCACA...

Protein

Download Protein FASTA

1038 aa · LXL04_002213|LXL04_002213|OH1004|PROTEIN

MGEDPVNLNEYQELARQALPKMYYDYFSGGSEDQHTLRENVEAFKRITLRPRILVDVSKIDMSTTILGYKTSAPIMIAPTAMHKLAHPEGEVLTARAAGSCDVIMGLSFMSTCTIEEVASSCNAVRLFQLYVYKKREISALMVKRAEANGFKAILLTVDTPKLGRREADIKNKMIAPQLKNFEGLVSTKVEDDEGSNLEAFAARSFDPSLSWKDIAWLKSITKLPILVKGILTREDAIKALEVGVEGIIVSNHGARQLDF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002213`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002213

Location Chr01:43840120-43845856 (-)

Description Similar to GLO4: Peroxisomal (S)-2-hydroxy-acid oxidase GLO4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14130`	Oxidase that catalyzes the oxidation of a broad range of 2-hydroxyacids to the corresponding 2-oxoacids, with a reduction of O2 to H2O2.	No verified direct reference in this release
`At3g14150`	Oxidase that catalyzes the oxidation of a broad range of 2-hydroxyacids to the corresponding 2-oxoacids, with a reduction of O2 to H2O2.	No verified direct reference in this release
`At4g18360`	Catalyzes the oxidation of glycolate to glyoxylate, with a reduction of O2 to H2O2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0616500`	Oxidase that catalyzes the oxidation of a broad range of 2-hydroxyacids to the corresponding 2-oxoacids, with a reduction of O2 to H2O2.	No verified direct reference in this release
`UniProt: B8B8K5`	Oxidase that catalyzes the oxidation of a broad range of 2-hydroxyacids to the corresponding 2-oxoacids, with a reduction of O2 to H2O2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002213 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0009853 photorespiration Biological Process

GO:0009854 oxidative photosynthetic carbon pathway Biological Process

GO:0010109 regulation of photosynthesis Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046718 symbiont entry into host cell Biological Process

GO:0050665 hydrogen peroxide biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003973 (S)-2-hydroxy-acid oxidase activity Molecular Function

GO:0010181 FMN binding Molecular Function

KEGG gene cross-reference

ath:AT3G14130

ath:AT3G14150

ath:AT4G18360

dosa:Os07g0616500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.605

Rank 1 · LXL04_002213 · OH-1004

Cytoplasm0.416

Rank 2 · LXL04_002213 · OH-1004

Endoplasmic reticulum0.046

Rank 3 · LXL04_002213 · OH-1004

Cell membrane0.044

Rank 4 · LXL04_002213 · OH-1004

Mitochondrion0.037

Rank 5 · LXL04_002213 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01070.25FMN_dh15-352 aa

PF00478.32IMPDH264-309 aa

PF04434.23SWIM871-898 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002213	`PF01070.25`	FMN_dh	15	352	4.8e-134	447.5
LXL04_002213	`PF00478.32`	IMPDH	264	309	8.3e-08	32.3
LXL04_002213	`PF04434.23`	SWIM	871	898	1.9e-07	31.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJH5`	Arabidopsis thaliana	Peroxisomal (S)-2-hydroxyacid oxidase GLO4	76.081%	Swiss-Prot	weak database homology
`Q24JJ8`	Arabidopsis thaliana	Peroxisomal (S)-2-hydroxyacid oxidase GLO3	73.775%	Swiss-Prot	weak database homology
`O49506`	Arabidopsis thaliana	Glycolate oxidase 3	62.464%	Swiss-Prot	weak database homology
`Q8H3I4`	Oryza sativa subsp. japonica	Peroxisomal (S)-2-hydroxy-acid oxidase GLO4	68.768%	Swiss-Prot	weak database homology
`B8B8K5`	Oryza sativa subsp. indica	Peroxisomal (S)-2-hydroxy-acid oxidase GLO4	67.908%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card