LXL04_002120 | RubberDandelionOmics

Gene overview

LXL04_002120

Reference: OH-1004 Chr: Chr01 Coordinates: 42118540-42120419 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1099 bp · LXL04_002120|LXL04_002120|OH1004|cDNA

ATGGCGAATTGGCCTGAATCATTCCAGCACAAGCACGTAGAATTCCGAGCTCCGCCACCCTCGCCGGTAGCTTCTGGCGGAAGATCTTCAGTTGTTAACGATGAGATTATCTCAGAATTTCTTCACCACTCGGTCCGTGTACCTGATCTTGTCCTACCGGATCGCGTTACCCCTCGTCAAAAGTTAAAGGTCCAGAAACTTCCTAAACTTGACTACAAAACACTGGAATCGTTGGAAGATCATAAGATCAGTAACAATTT...

CDS

Download CDS FASTA

1095 bp · LXL04_002120|LXL04_002120|OH1004|CDS

ATGGCGAATTGGCCTGAATCATTCCAGCACAAGCACGTAGAATTCCGAGCTCCGCCACCCTCGCCGGTAGCTTCTGGCGGAAGATCTTCAGTTGTTAACGATGAGATTATCTCAGAATTTCTTCACCACTCGGTCCGTGTACCTGATCTTGTCCTACCGGATCGCGTTACCCCTCGTCAAAAGTTAAAGGTCCAGAAACTTCCTAAACTTGACTACAAAACACTGGAATCGTTGGAAGATCATAAGATCAGTAACAATTT...

Protein

Download Protein FASTA

364 aa · LXL04_002120|LXL04_002120|OH1004|PROTEIN

MANWPESFQHKHVEFRAPPPSPVASGGRSSVVNDEIISEFLHHSVRVPDLVLPDRVTPRQKLKVQKLPKLDYKTLESLEDHKISNNFDVIARTGCFELVNHGISSQLVRVVAKYGAGIFELSPEKKAVMSMSADRMYSFEEFHGEENETSEEFVWCRDDALKSEMEAILPHRYANFSGKLEILTSEIERISGVILQYLFRNTPIKSGSEDDEASEKQNFDTICYFHRHHQDLNRIRNDNHYMNTMRYDMIRMLIRGSEHS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002120`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002120

Location Chr01:42118540-42120419 (-)

Description Similar to 1-aminocyclopropane-1-carboxylate oxidase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80330`	Converts the inactive gibberellin (GA) precursors GA9 and GA20 in the bioactives gibberellins GA4 and GA1.	Purification and kinetic studies of recombinant gibberellin dioxygenases.2005 · DOI: 10.1186/1471-2229-5-19 Distinct and overlapping roles of two gibberellin 3-oxidases in Arabidopsis development.2006 · DOI: 10.1111/j.1365-313x.2005.02642.x
`At4g25420`	Key oxidase enzyme in the biosynthesis of gibberellin that catalyzes the conversion of GA12 to GA9, via a three-step oxidation at C-20 of the GA skeleton.	The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle.2008 · DOI: 10.1111/j.1365-313x.2007.03356.x Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.1995 · DOI: 10.1104/pp.108.3.1049
`At1g78440`	Catalyzes the 2-beta-hydroxylation of several biologically active gibberellins, leading to the homeostatic regulation of their endogenous level.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002120 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0009686 gibberellin biosynthetic process Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009835 fruit ripening Biological Process

GO:0045487 gibberellin catabolic process Biological Process

GO:0048366 leaf development Biological Process

GO:0048575 short-day photoperiodism, flowering Biological Process

GO:0071398 cellular response to fatty acid Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G78440

ath:AT1G80330

ath:AT4G25420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.683

Rank 1 · LXL04_002120 · OH-1004

Cytoplasm0.315

Rank 2 · LXL04_002120 · OH-1004

Cell membrane0.060

Rank 3 · LXL04_002120 · OH-1004

Endoplasmic reticulum0.038

Rank 4 · LXL04_002120 · OH-1004

Plastid0.029

Rank 5 · LXL04_002120 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14226.13DIOX_N70-149 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002120	`PF14226.13`	DIOX_N	70	149	5e-06	27.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C971`	Arabidopsis thaliana	Gibberellin 3-beta-dioxygenase 4	19.291%	Swiss-Prot	weak database homology
`Q39110`	Arabidopsis thaliana	Gibberellin 20 oxidase 1	20.261%	Swiss-Prot	weak database homology
`Q8LEA2`	Arabidopsis thaliana	Gibberellin 2-beta-dioxygenase 1	21.514%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card