LXL04_002029 | RubberDandelionOmics

Gene overview

LXL04_002029

Reference: OH-1004 Chr: Chr01 Coordinates: 39799917-39801014 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · LXL04_002029|LXL04_002029|OH1004|cDNA

ATGGCAAGGgctttatcaagtatgttgtTCAAGGGTTTTAGGTCAATGGAATCTTCTCGCACAGCTGTATCTGCATCTGGACAATTCCTGCAGCATGGTATGCGGTTTTCTACAAGTGTTCCCAGTGATCCAGATACACACGATGATTTCAAGCCCACAAATAAGCTTGAGAATTCTGATGTTACCCTAAAGGACATTGTTGAGCAGGATGTGAAAGACAACCGTGTCATGATTTACATGAAAGGTGATCCAGAACAACC...

CDS

Download CDS FASTA

498 bp · LXL04_002029|LXL04_002029|OH1004|CDS

ATGGCAAGGGCTTTATCAAGTATGTTGTTCAAGGGTTTTAGGTCAATGGAATCTTCTCGCACAGCTGTATCTGCATCTGGACAATTCCTGCAGCATGGTATGCGGTTTTCTACAAGTGTTCCCAGTGATCCAGATACACACGATGATTTCAAGCCCACAAATAAGCTTGAGAATTCTGATGTTACCCTAAAGGACATTGTTGAGCAGGATGTGAAAGACAACCGTGTCATGATTTACATGAAAGGTGATCCAGAACAACC...

Protein

Download Protein FASTA

165 aa · LXL04_002029|LXL04_002029|OH1004|PROTEIN

MARALSSMLFKGFRSMESSRTAVSASGQFLQHGMRFSTSVPSDPDTHDDFKPTNKLENSDVTLKDIVEQDVKDNRVMIYMKGDPEQPQCGFSSLAVRVLSEYRVPIHSRNILEDPELKNAVKAFSMWPTFPQIFINGEFIGGSDIILNMHQNGELKEKIKGTSSE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002029`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002029

Location Chr01:39799917-39801014 (+)

Description Similar to GRXS15: Monothiol glutaredoxin-S15, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15660`	May only reduce GSH-thiol disulfides, but not protein disulfides.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0530400`	May only reduce GSH-thiol disulfides, but not protein disulfides.	No verified direct reference in this release
`Os01g0174900`	May only reduce GSH-thiol disulfides, but not protein disulfides.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002029 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0009249 protein lipoylation Biological Process

GO:0016226 iron-sulfur cluster assembly Biological Process

GO:0044571 [2Fe-2S] cluster assembly Biological Process

GO:0045454 cell redox homeostasis Biological Process

GO:0051604 protein maturation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:1990229 iron-sulfur cluster assembly complex Cellular Component

GO:0015036 disulfide oxidoreductase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G15660

dosa:Os01g0174900

dosa:Os01g0530400

hsa:51218

mmu:73046

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.942

Rank 1 · LXL04_002029 · OH-1004

Cytoplasm0.082

Rank 2 · LXL04_002029 · OH-1004

Nucleus0.080

Rank 3 · LXL04_002029 · OH-1004

Cell membrane0.026

Rank 4 · LXL04_002029 · OH-1004

Plastid0.019

Rank 5 · LXL04_002029 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00462.31Glutaredoxin76-140 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002029	`PF00462.31`	Glutaredoxin	76	140	2.8e-19	69.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LBK6`	Arabidopsis thaliana	Monothiol glutaredoxin-S15, mitochondrial	68.485%	Swiss-Prot	strong database homology
`Q0JM76`	Oryza sativa subsp. japonica	Monothiol glutaredoxin-S4, mitochondrial	52.601%	Swiss-Prot	strong database homology
`Q0JQ97`	Oryza sativa subsp. japonica	Monothiol glutaredoxin-S1, mitochondrial	51.445%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card