LXL04_001720 | RubberDandelionOmics

Gene overview

LXL04_001720

Reference: OH-1004 Chr: Chr01 Coordinates: 32004808-32008632 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2502 bp · LXL04_001720|LXL04_001720|OH1004|cDNA

ATGGGTCAAAAGGCCAAGGGAAAGCATCGTTTGGATAAGTTTTACCACTTGGCTAAAGAGCATGGCTACCGTTCTCGTGCTGTTTGGAAACTTATTCAGCTCGATTCCAAATTCACATTTCTCCGATCTTCTCACGCCGTCCTCGATCTCTGTGCCGCACCCGGTGGTTGGATGCAAGCTGCGGTTGAACGAGTGCCTGTTGGAAGCCTTGTGGTTGGTGTCGATCTTGACCCAATTCGCCCTATTCGTGGCGCCATCGC...

CDS

Download CDS FASTA

2502 bp · LXL04_001720|LXL04_001720|OH1004|CDS

ATGGGTCAAAAGGCCAAGGGAAAGCATCGTTTGGATAAGTTTTACCACTTGGCTAAAGAGCATGGCTACCGTTCTCGTGCTGTTTGGAAACTTATTCAGCTCGATTCCAAATTCACATTTCTCCGATCTTCTCACGCCGTCCTCGATCTCTGTGCCGCACCCGGTGGTTGGATGCAAGCTGCGGTTGAACGAGTGCCTGTTGGAAGCCTTGTGGTTGGTGTCGATCTTGACCCAATTCGCCCTATTCGTGGCGCCATCGC...

Protein

Download Protein FASTA

833 aa · LXL04_001720|LXL04_001720|OH1004|PROTEIN

MGQKAKGKHRLDKFYHLAKEHGYRSRAVWKLIQLDSKFTFLRSSHAVLDLCAAPGGWMQAAVERVPVGSLVVGVDLDPIRPIRGAIAVQEDITTPKCRATVKRLMSENGVKAFDLVLHDGSPNVGGAWAQEATSQNSLVIDSIKLASELLAPKGAFITKVFRSRDYNAVLYCLRQLFEKVEVDKPAASRSTSAEIYIVCLKYKAPAKIDPRLFDIRQLFQGGKEPPKVLDVLRGTKQKRNRDGYEDGDTTLRKTSSAFDF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001720`
TK1151 ID	TkA01G516290
OH-1004 ID	LXL04_001720
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_001720`
Location	Chr01:32004808-32008632 (-)
Description	Similar to spb1: AdoMet-dependent rRNA methyltransferase spb1 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001720` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000466 maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0001510 RNA methylation Biological Process GO:0031167 rRNA methylation Biological Process GO:1902626 assembly of large subunit precursor of preribosome Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0030684 preribosome Cellular Component GO:0030687 preribosome, large subunit precursor Cellular Component GO:0030688 preribosome, small subunit precursor Cellular Component GO:0008650 rRNA (uridine-2'-O-)-methyltransferase activity Molecular Function GO:0016435 rRNA (guanine) methyltransferase activity Molecular Function
KEGG gene cross-reference	afm:AFUA_5G12100 ani:ANIA_00092 mgr:MGG_08140 rno:303608 spo:2542112 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.948

Rank 1 · LXL04_001720 · OH-1004

Cytoplasm0.121

Rank 2 · LXL04_001720 · OH-1004

Mitochondrion0.025

Rank 3 · LXL04_001720 · OH-1004

Cell membrane0.014

Rank 4 · LXL04_001720 · OH-1004

Extracellular0.009

Rank 5 · LXL04_001720 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01728.26FtsJ23-202 aa

PF11861.14DUF3381235-383 aa

PF07780.18Spb1_C601-795 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001720	`PF01728.26`	FtsJ	23	202	1.1e-49	169.6
LXL04_001720	`PF11861.14`	DUF3381	235	383	9.4e-45	153.0
LXL04_001720	`PF07780.18`	Spb1_C	601	795	3.7e-59	200.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card