LXL04_001693 | RubberDandelionOmics

Gene overview

LXL04_001693

Reference: OH-1004 Chr: Chr01 Coordinates: 31455127-31458903 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1692 bp · LXL04_001693|LXL04_001693|OH1004|cDNA

ATGGTAGGCGATTCGGCGAACTCCCTCAGGCTTCCGGCGTTCCTCCTCCTACTCATGTTTTTGAACTCTGCCTGTCTCGTTCTTTCAGGAGAGCTGCCTTCTATAACGATTTCAAAAAAGCTTGCTTTATTGAGGATATCCCCAAAGTTGGTAGTAGACAAGTCTCCAGGTACTGAACCTGGATCTCGAGTGGTGTGTGAAAGAGTTCAAATTAATGGGCTCTCAAGGTTCAAAAACCTCAACAATTTCTTCTCTTCGGG...

CDS

Download CDS FASTA

1692 bp · LXL04_001693|LXL04_001693|OH1004|CDS

ATGGTAGGCGATTCGGCGAACTCCCTCAGGCTTCCGGCGTTCCTCCTCCTACTCATGTTTTTGAACTCTGCCTGTCTCGTTCTTTCAGGAGAGCTGCCTTCTATAACGATTTCAAAAAAGCTTGCTTTATTGAGGATATCCCCAAAGTTGGTAGTAGACAAGTCTCCAGGTACTGAACCTGGATCTCGAGTGGTGTGTGAAAGAGTTCAAATTAATGGGCTCTCAAGGTTCAAAAACCTCAACAATTTCTTCTCTTCGGG...

Protein

Download Protein FASTA

563 aa · LXL04_001693|LXL04_001693|OH1004|PROTEIN

MVGDSANSLRLPAFLLLLMFLNSACLVLSGELPSITISKKLALLRISPKLVVDKSPGTEPGSRVVCERVQINGLSRFKNLNNFFSSGRVRVFNKNANVHSPNISICFHRNASLAVCMCSEGQWSLMESFWARSLSPFSHKLFLDIRLVGPHPSPRSLDVKVHNEFFLSRLLYLVSGILLMSFATPLSKSYIVYYGVGMTMGYILVALAIFCEAMRILTYGNKIFACALYAFIIAIGSFSFGYIPTIFYLLLAKVGISEDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001693`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001693

Location Chr01:31455127-31458903 (+)

Description Similar to bVPE: Vacuolar-processing enzyme beta-isozyme

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g62710`	Asparagine-specific endopeptidase involved in the processing of vacuolar seed protein precursors into the mature forms (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001693 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006624 vacuolar protein processing Biological Process

GO:0051603 proteolysis involved in protein catabolic process Biological Process

GO:0000326 protein storage vacuole Cellular Component

GO:0005773 vacuole Cellular Component

GO:0004197 cysteine-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G62710

gmx:547964

rcu:8272115

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.363

Rank 1 · LXL04_001693 · OH-1004

Golgi apparatus0.198

Rank 2 · LXL04_001693 · OH-1004

Cell membrane0.180

Rank 3 · LXL04_001693 · OH-1004

Nucleus0.161

Rank 4 · LXL04_001693 · OH-1004

Cytoplasm0.133

Rank 5 · LXL04_001693 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10225.15NEMP159-350 aa

PF20985.3Legum_prodom465-551 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001693	`PF10225.15`	NEMP	159	350	1.1e-16	62.0
LXL04_001693	`PF20985.3`	Legum_prodom	465	551	1.1e-23	84.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39044`	Arabidopsis thaliana	Vacuolar-processing enzyme beta-isozyme	42.373%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card