Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2966 bp · LXL04_001662|LXL04_001662|OH1004|cDNA
ATGAAGGGCATGGAGACTTTACAGGATCTGATCGAAGAAGCAAAGCTTCGTACTGTGTGGTGGGCTCTTTGTATCTTCGCAGTTTCCTACTTCTTAGCTCACACAAGTAAATCAATGTGGATGAATGTTCCTATAGCAATACTCATGGTATCATGTTCACGAATTTTGTTAAACGAAGTTGAATTCCGTTGGAAGACCAGAAAAACCCGGCCACCAACATATCTATCGCACTTAGAAAAAAAGCAATTATCCGTCAACGA...
2949 bp · LXL04_001662|LXL04_001662|OH1004|CDS
ATGAAGGGCATGGAGACTTTACAGGATCTGATCGAAGAAGCAAAGCTTCGTACTGTGTGGTGGGCTCTTTGTATCTTCGCAGTTTCCTACTTCTTAGCTCACACAAGTAAATCAATGTGGATGAATGTTCCTATAGCAATACTCATGGTATCATGTTCACGAATTTTGTTAAACGAAGTTGAATTCCGTTGGAAGACCAGAAAAACCCGGCCACCAACATATCTATCGCACTTAGAAAAAAAGCAATTATCCGTCAACGA...
Protein
Download Protein FASTA982 aa · LXL04_001662|LXL04_001662|OH1004|PROTEIN
MKGMETLQDLIEEAKLRTVWWALCIFAVSYFLAHTSKSMWMNVPIAILMVSCSRILLNEVEFRWKTRKTRPPTYLSHLEKKQLSVNDSRLSTLPAPSKWKRKVDSPMVESAMEDFINKLLQDFVVDLWYSDITPDKEAPELMRSIIMDVLAEISARVKSTNLVDLLTRDVVDLVGVHLELFRKNQAAIGVEVMVTLSSEERDERLKHHLMASKELHPALLSPESEYKFLKRIMGAVLAVVLKPREAQSPLVRCIARELLT...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_001662 |
|---|---|
| TK1151 ID | TkA01G520160 |
| OH-1004 ID | LXL04_001662 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 97.200 |
| Protein coverage (%) | TK1151 99.469 / OH-1004 76.273Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_001662 |
|---|---|
| Location | Chr01:30871046-30875968 (-) |
| Description | Similar to SNX16: Sorting nexin-16 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001881 receptor recycling Biological Process GO:0006622 protein targeting to lysosome Biological Process GO:0008333 endosome to lysosome transport Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0045022 early endosome to late endosome transport Biological Process GO:0005764 lysosome Cellular Component GO:0005769 early endosome Cellular Component GO:0005770 late endosome Cellular Component GO:0010008 endosome membrane Cellular Component GO:0031410 cytoplasmic vesicle Cellular Component GO:0031901 early endosome membrane Cellular Component GO:0031902 late endosome membrane Cellular Component |
| KEGG gene cross-reference | hsa:64089 mmu:74718 pon:100173483 rno:64088 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02194.21PXA105-281 aaPF00787.30PX540-616 aaPF08628.18Nexin_C811-947 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_001662 | PF02194.21 | PXA | 105 | 281 | 2.4e-38 | 132.9 |
| LXL04_001662 | PF00787.30 | PX | 540 | 616 | 1.1e-15 | 58.6 |
| LXL04_001662 | PF08628.18 | Nexin_C | 811 | 947 | 5.1e-25 | 88.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.