LXL04_001496 | RubberDandelionOmics

Gene overview

LXL04_001496

Reference: OH-1004 Chr: Chr01 Coordinates: 27717127-27717672 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

375 bp · LXL04_001496|LXL04_001496|OH1004|cDNA

ATGTTTCCATGCGAAATTCCTAATTTATCCTTATTCAAGCTTGACAAGATCTATAAATTCATACCCCACATAGTCTTTCTTCTTCCCATCCAAGATCATAGAGAAAAGTCAGACATGTTTAAGGCTATTAGAGTCACCACCCTTTGCATGATAGCAATCCTCCTCCTTTCCATGCTATCTCACACCACTGCCCGCCCTACCCCGATCTTCAAAGATGTTACCCCCATGGAAACTCATCACACGGATGAAGAGGTGGCAAA...

CDS

Download CDS FASTA

375 bp · LXL04_001496|LXL04_001496|OH1004|CDS

ATGTTTCCATGCGAAATTCCTAATTTATCCTTATTCAAGCTTGACAAGATCTATAAATTCATACCCCACATAGTCTTTCTTCTTCCCATCCAAGATCATAGAGAAAAGTCAGACATGTTTAAGGCTATTAGAGTCACCACCCTTTGCATGATAGCAATCCTCCTCCTTTCCATGCTATCTCACACCACTGCCCGCCCTACCCCGATCTTCAAAGATGTTACCCCCATGGAAACTCATCACACGGATGAAGAGGTGGCAAA...

Protein

Download Protein FASTA

124 aa · LXL04_001496|LXL04_001496|OH1004|PROTEIN

MFPCEIPNLSLFKLDKIYKFIPHIVFLLPIQDHREKSDMFKAIRVTTLCMIAILLLSMLSHTTARPTPIFKDVTPMETHHTDEEVANARTEEKCTGPGEEECLMRRTLAAHLDYIYTRNKPTLN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001496`
TK1151 ID	TkA01G531370
OH-1004 ID	LXL04_001496
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	76.500
Protein coverage (%)	TK1151 97.030 / OH-1004 74.194 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001496

Location Chr01:27717127-27717672 (+)

Description Similar to PSK5: Phytosulfokines 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65870`	Promotes plant cell differentiation, organogenesis and somatic embryogenesis as well as cell proliferation (By similarity).	No verified direct reference in this release
`At3g49780`	Promotes plant cell differentiation, organogenesis and somatic embryogenesis as well as cell proliferation.	No verified direct reference in this release
`At2g22860`	Promotes plant cell differentiation, organogenesis and somatic embryogenesis as well as cell proliferation.	No verified direct reference in this release
`At4g37720`	Promotes plant cell differentiation, organogenesis and somatic embryogenesis as well as cell proliferation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001496 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0008283 cell population proliferation Biological Process

GO:0030154 cell differentiation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0031012 extracellular matrix Cellular Component

GO:0008083 growth factor activity Molecular Function

KEGG gene cross-reference

ath:AT2G22860

ath:AT3G49780

ath:AT4G37720

ath:AT5G65870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.658

Rank 1 · LXL04_001496 · OH-1004

Endoplasmic reticulum0.155

Rank 2 · LXL04_001496 · OH-1004

Cell membrane0.139

Rank 3 · LXL04_001496 · OH-1004

Cytoplasm0.084

Rank 4 · LXL04_001496 · OH-1004

Golgi apparatus0.060

Rank 5 · LXL04_001496 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06404.18PSK78-120 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001496	`PF06404.18`	PSK	78	120	7.9e-14	53.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FEB4`	Arabidopsis thaliana	Phytosulfokines 5	50.667%	Swiss-Prot	moderate database homology
`Q9M2Y0`	Arabidopsis thaliana	Phytosulfokines 3	43.750%	Swiss-Prot	moderate database homology
`O81003`	Arabidopsis thaliana	Phytosulfokines 2	41.667%	Swiss-Prot	moderate database homology
`Q9SZG4`	Arabidopsis thaliana	Putative phytosulfokines 4	38.554%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card