LXL04_001401 | RubberDandelionOmics

Gene overview

LXL04_001401

Reference: OH-1004 Chr: Chr01 Coordinates: 25698436-25701561 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

912 bp · LXL04_001401|LXL04_001401|OH1004|cDNA

ATGGCCAATATCTCTCTCCGTTTTGGTACGATTGCATGTAAATCCGTATCTTCATCCCACGACACATGCTCCAAAAATACAAACTTTTACCAATTGCTTTCTTTAAGCTCAAGCAAAGCCGGAAACCAAGAGATCAAAAGAGCTTATAGAACACTAGTTCTCAAGTACCATCCCGATGTTTCTCATGATCATGACACCACCAAAACCTTCATTATGTTGCATGCAGCCTATAAGACACTCATGGATCCAGAATTACGAGC...

CDS

Download CDS FASTA

912 bp · LXL04_001401|LXL04_001401|OH1004|CDS

ATGGCCAATATCTCTCTCCGTTTTGGTACGATTGCATGTAAATCCGTATCTTCATCCCACGACACATGCTCCAAAAATACAAACTTTTACCAATTGCTTTCTTTAAGCTCAAGCAAAGCCGGAAACCAAGAGATCAAAAGAGCTTATAGAACACTAGTTCTCAAGTACCATCCCGATGTTTCTCATGATCATGACACCACCAAAACCTTCATTATGTTGCATGCAGCCTATAAGACACTCATGGATCCAGAATTACGAGC...

Protein

Download Protein FASTA

303 aa · LXL04_001401|LXL04_001401|OH1004|PROTEIN

MANISLRFGTIACKSVSSSHDTCSKNTNFYQLLSLSSSKAGNQEIKRAYRTLVLKYHPDVSHDHDTTKTFIMLHAAYKTLMDPELRAEYDCTLGCHGCRITDDDVGVEGRRWEAQIVELRKRSSYRVDRKEGSWGSRAGVHYRQPVSREVPKQTTDEDERQIGRRQSTESSDVRRFLIPPSPSFSIADDSPARFHFLIPILETSELSNPIDVLKFMKELDYFPNACIAYRILLTIPVTVASAERSFSKLKLLKSYLRFTM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001401`
TK1151 ID	TkA01G539920
OH-1004 ID	LXL04_001401
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 93.243 / OH-1004 45.545 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001401

Location Chr01:25698436-25701561 (-)

Description Similar to Dnajb14: DnaJ homolog subfamily B member 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13830`	Plays a continuous role in plant development probably in the structural organization of compartments.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001401 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0010322 regulation of isopentenyl diphosphate biosynthetic process, methylerythritol 4-phosphate pathway Biological Process

GO:0042026 protein refolding Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0071218 cellular response to misfolded protein Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT4G13830

bta:538849

hsa:79982

mmu:70604

tel:tll0790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.520

Rank 1 · LXL04_001401 · OH-1004

Cytoplasm0.318

Rank 2 · LXL04_001401 · OH-1004

Mitochondrion0.113

Rank 3 · LXL04_001401 · OH-1004

Cell membrane0.032

Rank 4 · LXL04_001401 · OH-1004

Peroxisome0.032

Rank 5 · LXL04_001401 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226.37DnaJ28-90 aa

PF05699.20Dimer_Tnp_hAT201-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001401	`PF00226.37`	DnaJ	28	90	1.2e-17	64.5
LXL04_001401	`PF05699.20`	Dimer_Tnp_hAT	201	277	3.1e-15	56.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SDN0`	Arabidopsis thaliana	Chaperone protein dnaJ 20, chloroplastic	35.135%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card