LXL04_001396 | RubberDandelionOmics

Gene overview

LXL04_001396

Reference: OH-1004 Chr: Chr01 Coordinates: 25579188-25581833 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1569 bp · LXL04_001396|LXL04_001396|OH1004|cDNA

ATGATGGAGAAGATGGGCGATGGAAGCACCCCCTTTTGGCTTCCCCAGAACCAAATTCGTGGAGTAGCTATCCACTTCCCATCAAACTCAGCTCCGCCGCCTCCATCAAAAGTAATGGCTGGAAGTATCGATATGATGTTACGTGACCTTAACCTGGACGCCGTTGAATCTTTACCGGAGGATTTTGATCCGACTACTGTGATCAACGATCCTCTGCCGCCAATTGCTAATGATGCGTTGCATACAAACGGGGTAAAGTC...

CDS

Download CDS FASTA

1569 bp · LXL04_001396|LXL04_001396|OH1004|CDS

ATGATGGAGAAGATGGGCGATGGAAGCACCCCCTTTTGGCTTCCCCAGAACCAAATTCGTGGAGTAGCTATCCACTTCCCATCAAACTCAGCTCCGCCGCCTCCATCAAAAGTAATGGCTGGAAGTATCGATATGATGTTACGTGACCTTAACCTGGACGCCGTTGAATCTTTACCGGAGGATTTTGATCCGACTACTGTGATCAACGATCCTCTGCCGCCAATTGCTAATGATGCGTTGCATACAAACGGGGTAAAGTC...

Protein

Download Protein FASTA

522 aa · LXL04_001396|LXL04_001396|OH1004|PROTEIN

MMEKMGDGSTPFWLPQNQIRGVAIHFPSNSAPPPPSKVMAGSIDMMLRDLNLDAVESLPEDFDPTTVINDPLPPIANDALHTNGVKSINGKEKPREIVLGRNVHTSCHEVTEPDADDDDSGDREAYMASVLARYRKSLVERTKHHLGYPYNLDFDYGALSQLQHFSINNLGDPFIESNYGVHSRQFEVGVLDWFARLWELEKNEYWGYITNCGTEGNLHGILVGREVFPDGILYASCESHYSIFKAARMYRMDCEKVNTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001396`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001396

Location Chr01:25579188-25581833 (+)

Description Similar to SDC1: Serine decarboxylase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g43710`	Catalyzes the biosynthesis of ethanolamine from serine.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0541325`	Catalyzes the biosynthesis of ethanolamine from serine.	No verified direct reference in this release
`Os10g0105700`	Catalyzes the biosynthesis of ethanolamine from serine.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001396 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006522 alanine metabolic process Biological Process

GO:0006563 L-serine metabolic process Biological Process

GO:0006580 ethanolamine metabolic process Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0019752 carboxylic acid metabolic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016831 carboxy-lyase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0102705 serine decarboxylase activity Molecular Function

KEGG gene cross-reference

ath:AT1G43710

dosa:Os02g0541300

dosa:Os10g0105700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.647

Rank 1 · LXL04_001396 · OH-1004

Nucleus0.344

Rank 2 · LXL04_001396 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_001396 · OH-1004

Endoplasmic reticulum0.062

Rank 4 · LXL04_001396 · OH-1004

Mitochondrion0.060

Rank 5 · LXL04_001396 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00282.26Pyridoxal_deC232-440 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001396	`PF00282.26`	Pyridoxal_deC	232	440	8.4e-21	74.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MA74`	Arabidopsis thaliana	Serine decarboxylase	76.858%	Swiss-Prot	strong database homology
`Q6ESZ9`	Oryza sativa subsp. japonica	Serine decarboxylase 1	77.800%	Swiss-Prot	strong database homology
`Q8RV06`	Oryza sativa subsp. japonica	Serine decarboxylase 2	59.080%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card