RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_001305
Reference: OH-1004 Chr: Chr01 Coordinates: 23827001-23828488 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1488 bp · LXL04_001305|LXL04_001305|OH1004|cDNA

ATGAATATCAGATGGCCACGGGTACTAACACCAACATACCTATCTCAGCTCATCAGAGCCCAGAAAAACCCAATAAAAGccctccaaatcttcaatgaAGCAAGAAACAAATACCCAAATTACCGCCACAATGGCCCTGTATACGCCACCATGATCAACAAACTCATCGCATCAGATCAAATCCTCAATATGAAACAAGTAATCAATCAAATGAAGAACGACTCATGTGAGTGTCAAGATTCAGTCTTTTCAACTGCAAT...

CDS

Download CDS FASTA

1488 bp · LXL04_001305|LXL04_001305|OH1004|CDS

ATGAATATCAGATGGCCACGGGTACTAACACCAACATACCTATCTCAGCTCATCAGAGCCCAGAAAAACCCAATAAAAGCCCTCCAAATCTTCAATGAAGCAAGAAACAAATACCCAAATTACCGCCACAATGGCCCTGTATACGCCACCATGATCAACAAACTCATCGCATCAGATCAAATCCTCAATATGAAACAAGTAATCAATCAAATGAAGAACGACTCATGTGAGTGTCAAGATTCAGTCTTTTCAACTGCAAT...

Protein

Download Protein FASTA

495 aa · LXL04_001305|LXL04_001305|OH1004|PROTEIN

MNIRWPRVLTPTYLSQLIRAQKNPIKALQIFNEARNKYPNYRHNGPVYATMINKLIASDQILNMKQVINQMKNDSCECQDSVFSTAIKAYAKSGMLNESISLFKNLHHFNCVNWTESFNTILQIMVKESRFESAHNLFLQNFSKWEVKSRTRSLTWLIEVLCENKRSDLALHIFQEMNHQYCYPTIDTYKTLMKGLCEDGKINEAIHLLYSMFWRISQKGSGEDVLVYKILLDTLCSHGHVEEASDILNKVLRKGLKAPK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_001305
TK1151 IDTkA01G548590
OH-1004 IDLXL04_001305
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)89.700
Protein coverage (%)TK1151 93.393 / OH-1004 62.828
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_001305
LocationChr01:23827001-23828488 (-)
DescriptionSimilar to At1g05600: Pentatricopeptide repeat-containing protein At1g05600
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g05600 Pentatricopeptide repeat-containing protein At1g05600. No verified direct reference in this release
At1g74580 Putative pentatricopeptide repeat-containing protein At1g74580. No verified direct reference in this release
At1g02060 Pentatricopeptide repeat-containing protein At1g02060, chloroplastic. No verified direct reference in this release
At5g46100 Pentatricopeptide repeat-containing protein At5g46100. No verified direct reference in this release
At5g64320 Pentatricopeptide repeat-containing protein At5g64320, mitochondrial. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001305 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000963 mitochondrial RNA processing Biological Process
GO:0008380 RNA splicing Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0003729 mRNA binding Molecular Function
KEGG gene cross-reference
ath:AT1G05600
ath:AT1G74580
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.803
Rank 1 · LXL04_001305 · OH-1004
Plastid0.093
Rank 2 · LXL04_001305 · OH-1004
Nucleus0.058
Rank 3 · LXL04_001305 · OH-1004
Cytoplasm0.039
Rank 4 · LXL04_001305 · OH-1004
Cell membrane0.011
Rank 5 · LXL04_001305 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N25-175 aa
PF23276.3TPR_2466-177 aa
PF13812.13PPR_3155-194 aa
PF13041.13PPR_2156-197 aa
PF12854.14PPR_1182-212 aa
PF13812.13PPR_3283-336 aa
PF13041.13PPR_2296-343 aa
PF13041.13PPR_2361-411 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_001305PF29070.1MSC6_N251751.6e-1248.0
LXL04_001305PF23276.3TPR_24661779.5e-1452.2
LXL04_001305PF13812.13PPR_31551943.4e-2072.6
LXL04_001305PF13041.13PPR_21561974.7e-46155.4
LXL04_001305PF12854.14PPR_11822121.4e-41140.6
LXL04_001305PF13812.13PPR_32833363.4e-2072.6
LXL04_001305PF13041.13PPR_22963434.7e-46155.4
LXL04_001305PF13041.13PPR_23614114.7e-46155.4
LXL04_001305PF12854.14PPR_13944251.4e-41140.6
LXL04_001305PF01535.27PPR4014276.8e-43142.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SYK1Arabidopsis thalianaPentatricopeptide repeat-containing protein At1g0560052.697%Swiss-Protstrong database homology
Q9CA58Arabidopsis thalianaPutative pentatricopeptide repeat-containing protein At1g7458026.271%Swiss-Protweak database homology
O81908Arabidopsis thalianaPentatricopeptide repeat-containing protein At1g02060, chloroplastic25.050%Swiss-Protweak database homology
Q9FNL2Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g4610026.211%Swiss-Protweak database homology
Q9FMF6Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g64320, mitochondrial25.397%Swiss-Protweak database homology

JBrowse

View in Genome Browser