Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1965 bp · LXL04_001275|LXL04_001275|OH1004|cDNA
ATGGGATGGACCGTAGTCCGCCGGAATAACCGGCAGGCGAATGAACAAGATGACGAAACCACGTACTTCGTAACAAACGTGCCAAGAGAAGCCACAAAAGGAGAAATACGAAAGGTGTTCGAAAGATTTGGAAGGGTTTCAGATGTCTGGATGGGAACCAACATTGGCAAAAATGGGAAACACTATGCTTTCCTAAGATTTACAGGGGTGAAAGATACCAAAGAAATGGAGAAACAAATAGACGGGACAAAGATACGGGG...
1965 bp · LXL04_001275|LXL04_001275|OH1004|CDS
ATGGGATGGACCGTAGTCCGCCGGAATAACCGGCAGGCGAATGAACAAGATGACGAAACCACGTACTTCGTAACAAACGTGCCAAGAGAAGCCACAAAAGGAGAAATACGAAAGGTGTTCGAAAGATTTGGAAGGGTTTCAGATGTCTGGATGGGAACCAACATTGGCAAAAATGGGAAACACTATGCTTTCCTAAGATTTACAGGGGTGAAAGATACCAAAGAAATGGAGAAACAAATAGACGGGACAAAGATACGGGG...
Protein
Download Protein FASTA654 aa · LXL04_001275|LXL04_001275|OH1004|PROTEIN
MGWTVVRRNNRQANEQDDETTYFVTNVPREATKGEIRKVFERFGRVSDVWMGTNIGKNGKHYAFLRFTGVKDTKEMEKQIDGTKIRGKILEVNIAIHGMRDPPRQPTRQETRKRITEPQMMDGNKPSTFWKNSSRDHRSYADLMRTTPTDNHPPPGPPLPTPIILQREPETHSWLRKTALVGEATSLNHLGHLPKLIFNKGEAGIEIKYIGGLMVLILFDWSVNAKKFMEDESRWREHLKWLKWGEKANTHFERVAWIRI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_001275 |
|---|---|
| TK1151 ID | TkA02G084120 |
| OH-1004 ID | LXL04_001275 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 51.400 |
| Protein coverage (%) | TK1151 98.646 / OH-1004 84.709Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_001275 |
|---|---|
| Location | Chr01:23334482-23336446 (+) |
| Description | Similar to SRSF8: Serine/arginine-rich splicing factor 8 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process GO:0001732 formation of cytoplasmic translation initiation complex Biological Process GO:0002188 translation reinitiation Biological Process GO:0006397 mRNA processing Biological Process GO:0006415 translational termination Biological Process GO:0008380 RNA splicing Biological Process GO:0005654 nucleoplasm Cellular Component GO:0016282 eukaryotic 43S preinitiation complex Cellular Component GO:0016607 nuclear speck Cellular Component GO:0033290 eukaryotic 48S preinitiation complex Cellular Component GO:0043614 multi-eIF complex Cellular Component GO:0071540 eukaryotic translation initiation factor 3 complex, eIF3e Cellular Component |
| KEGG gene cross-reference | act:ACLA_068950 ang:An16g05260 aor:AO090011000648 hsa:10929 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00076.29RRM_123-90 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_001275 | PF00076.29 | RRM_1 | 23 | 90 | 1.3e-09 | 38.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.