LXL04_001271 | RubberDandelionOmics

Gene overview

LXL04_001271

Reference: OH-1004 Chr: Chr01 Coordinates: 23290223-23293763 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1956 bp · LXL04_001271|LXL04_001271|OH1004|cDNA

ATGTACCCTGGAACACGAGAATGGTGGCAAAGAAGGACAGAGGGTCGAGCTGCCATTTCTGGTAACAATATCAGGTGGGCCATACCCATCCATTACCCATTCAGAGCTACAATTATGGGCGTTGATGACAAAACTCTCAAGTTATCCAGTGATGGTATGACTATAACTCACCAAGAATGGCCCATGTCCCTGCACGCCTATTCAGATCTCACCAATGTTTCTCCAGTAGTCTTCTTATATCTTCTGAAAGAATGTTATCT...

CDS

Download CDS FASTA

1956 bp · LXL04_001271|LXL04_001271|OH1004|CDS

ATGTACCCTGGAACACGAGAATGGTGGCAAAGAAGGACAGAGGGTCGAGCTGCCATTTCTGGTAACAATATCAGGTGGGCCATACCCATCCATTACCCATTCAGAGCTACAATTATGGGCGTTGATGACAAAACTCTCAAGTTATCCAGTGATGGTATGACTATAACTCACCAAGAATGGCCCATGTCCCTGCACGCCTATTCAGATCTCACCAATGTTTCTCCAGTAGTCTTCTTATATCTTCTGAAAGAATGTTATCT...

Protein

Download Protein FASTA

651 aa · LXL04_001271|LXL04_001271|OH1004|PROTEIN

MYPGTREWWQRRTEGRAAISGNNIRWAIPIHYPFRATIMGVDDKTLKLSSDGMTITHQEWPMSLHAYSDLTNVSPVVFLYLLKECYLYGKLLISSIFSTSLSSLNVTKISNETGTCKATAKFFSLQHQVLQALHNVPKPGPAVFVANCLSLLPIFESHCEGFSHLMISALRRFLKKGTTNEDLHEAKLLATQLFIISVRGNNTHDDRILVKILEVFNIKLTDIKEVMFQFHLNVKNDKVEDIADVFIEQFISKLLQSQSY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001271`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001271

Location Chr01:23290223-23293763 (-)

Description Similar to EXD3: Exonuclease mut-7 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13870`	Exonuclease that digests recessed strands of DNA duplexes in the 3' to 5' direction but hardly single-stranded DNA or blunt-ended duplexes.	Biochemical characterization of an exonuclease from Arabidopsis thaliana reveals similarities to the DNA exonuclease of the human Werner syndrome protein.2003 · DOI: 10.1074/jbc.m303891200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001271 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006139 nucleobase-containing compound metabolic process Biological Process

GO:0010526 transposable element silencing Biological Process

GO:0016441 post-transcriptional gene silencing Biological Process

GO:0035194 regulatory ncRNA-mediated post-transcriptional gene silencing Biological Process

GO:0035196 miRNA processing Biological Process

GO:0044747 pre-miRNA 3'-end processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:1990633 mutator focus Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0000175 3'-5'-RNA exonuclease activity Molecular Function

KEGG gene cross-reference

aag:5579811

ath:AT4G13870

cel:CELE_ZK1098.8

dme:Dmel_CG9247

hsa:54932

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.472

Rank 1 · LXL04_001271 · OH-1004

Nucleus0.455

Rank 2 · LXL04_001271 · OH-1004

Cell membrane0.103

Rank 3 · LXL04_001271 · OH-1004

Mitochondrion0.078

Rank 4 · LXL04_001271 · OH-1004

Endoplasmic reticulum0.074

Rank 5 · LXL04_001271 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01612.27DNA_pol_A_exo1423-594 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001271	`PF01612.27`	DNA_pol_A_exo1	423	594	1.8e-22	80.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84LH3`	Arabidopsis thaliana	3'-5' exonuclease	31.646%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card