LXL04_001159 | RubberDandelionOmics

Gene overview

LXL04_001159

Reference: OH-1004 Chr: Chr01 Coordinates: 21215580-21219325 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2553 bp · LXL04_001159|LXL04_001159|OH1004|cDNA

ATGGCGGAGACGAAAAGGAAGAAATCCATAGCTCCTACAAACAGTTTAAAGAGGAGAAAGGGAGGTAAAGAGAAGATTTGGAAAAAAGGTCCTCATTTACCCAACGCATTGCAAAAAGAGCTTAATTCCCTAAACCCTACCGATAGAAGCGACGAAGAAATCCACTCTGATGACGACATCGATGTTTATGAATACGAAGAAAATATCCCAGATGAAGAGTCAAAGAAGAACCGCAGGTACGACCCCGTTGATAACTTCGA...

CDS

Download CDS FASTA

2553 bp · LXL04_001159|LXL04_001159|OH1004|CDS

ATGGCGGAGACGAAAAGGAAGAAATCCATAGCTCCTACAAACAGTTTAAAGAGGAGAAAGGGAGGTAAAGAGAAGATTTGGAAAAAAGGTCCTCATTTACCCAACGCATTGCAAAAAGAGCTTAATTCCCTAAACCCTACCGATAGAAGCGACGAAGAAATCCACTCTGATGACGACATCGATGTTTATGAATACGAAGAAAATATCCCAGATGAAGAGTCAAAGAAGAACCGCAGGTACGACCCCGTTGATAACTTCGA...

Protein

Download Protein FASTA

850 aa · LXL04_001159|LXL04_001159|OH1004|PROTEIN

MAETKRKKSIAPTNSLKRRKGGKEKIWKKGPHLPNALQKELNSLNPTDRSDEEIHSDDDIDVYEYEENIPDEESKKNRRYDPVDNFEYELPKDFEDEDVASDDDDEEEKGFHKRYSDDDDNEDSDDNDDEKHSRMLQDITGLPGDAFEGKKKKKDVVVFEAYPESEYNPSRDVLDGDGRITVDDLLNPLHGKPGFSKIRKDVQRMDKKSISTQLQPPLPKPQQQKVDRRSAYVYSKKKLHEYEALVKKNREAPTIYFDED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001159`
TK1151 ID	TkA01G557470
OH-1004 ID	LXL04_001159
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 89.323 / OH-1004 40.471 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_001159`
Location	Chr01:21215580-21219325 (-)
Description	Similar to UTP14: U3 small nucleolar RNA-associated protein 14 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001159` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000447 endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000472 endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000480 endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006364 rRNA processing Biological Process GO:0007283 spermatogenesis Biological Process GO:0030154 cell differentiation Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005829 cytosol Cellular Component GO:0032040 small-subunit processome Cellular Component
KEGG gene cross-reference	bta:505324 hsa:9724 mmu:195434 sce:YML093W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.964

Rank 1 · LXL04_001159 · OH-1004

Cytoplasm0.105

Rank 2 · LXL04_001159 · OH-1004

Mitochondrion0.017

Rank 3 · LXL04_001159 · OH-1004

Cell membrane0.013

Rank 4 · LXL04_001159 · OH-1004

Extracellular0.007

Rank 5 · LXL04_001159 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04615.19Utp14134-846 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001159	`PF04615.19`	Utp14	134	846	3.4e-174	582.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card