LXL04_001130 | RubberDandelionOmics

Gene overview

LXL04_001130

Reference: OH-1004 Chr: Chr01 Coordinates: 20853452-20856323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1461 bp · LXL04_001130|LXL04_001130|OH1004|cDNA

ATGGGTTTCAGATACTTTAGTGTAAATCTCCTCAAAAGATTTCACAAATCATCAGCAAGATCCATTCCATCTTCATTCACTCACAAGAAACTGGTGTACGTGTACCCTTTGATACACCGGTTGTACGATCGTTCATCCCCCTACCCAGAAAATCATAGCTTAAAGATCTCCAAGAGGTGGCATGTCGGTCATTCTCACCACCACCACGACCAAACCAGTGAAGAAGGCGAGAGAATTTTCAGGCTCGGACTCGCCGCCGA...

CDS

Download CDS FASTA

1461 bp · LXL04_001130|LXL04_001130|OH1004|CDS

ATGGGTTTCAGATACTTTAGTGTAAATCTCCTCAAAAGATTTCACAAATCATCAGCAAGATCCATTCCATCTTCATTCACTCACAAGAAACTGGTGTACGTGTACCCTTTGATACACCGGTTGTACGATCGTTCATCCCCCTACCCAGAAAATCATAGCTTAAAGATCTCCAAGAGGTGGCATGTCGGTCATTCTCACCACCACCACGACCAAACCAGTGAAGAAGGCGAGAGAATTTTCAGGCTCGGACTCGCCGCCGA...

Protein

Download Protein FASTA

486 aa · LXL04_001130|LXL04_001130|OH1004|PROTEIN

MGFRYFSVNLLKRFHKSSARSIPSSFTHKKLVYVYPLIHRLYDRSSPYPENHSLKISKRWHVGHSHHHHDQTSEEGERIFRLGLAADIGLTAGKALTGYLSGSTAIIADAAHSLSDVVLSGVALLSFKASRVPKDKEHPYGHGKFETLGALGISGVLLVTAGGIAWHALDVLLPSNLLLQGVLSAASDIANQESHSHIGHEIDMNHPVLALNTTIVAIVVKEGLYWITKRAGEKSGSGLMKANAWHHRADAVSSLVALIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001130`
TK1151 ID	TkA01G558600
OH-1004 ID	LXL04_001130
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 58.230 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001130

Location Chr01:20853452-20856323 (+)

Description Similar to MTPC1: Metal tolerance protein C1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47830`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0346800`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001130 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006826 iron ion transport Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0030003 intracellular monoatomic cation homeostasis Biological Process

GO:0048250 iron import into the mitochondrion Biological Process

GO:0098771 inorganic ion homeostasis Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

KEGG gene cross-reference

ath:AT2G47830

dosa:Os03g0346800

mgy:MGMSRv2__2368

sce:YPL224C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.918

Rank 1 · LXL04_001130 · OH-1004

Cytoplasm0.067

Rank 2 · LXL04_001130 · OH-1004

Nucleus0.049

Rank 3 · LXL04_001130 · OH-1004

Cell membrane0.034

Rank 4 · LXL04_001130 · OH-1004

Plastid0.029

Rank 5 · LXL04_001130 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01545.27Cation_efflux82-299 aa

PF16916.12ZT_dimer304-380 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001130	`PF01545.27`	Cation_efflux	82	299	5.4e-41	141.3
LXL04_001130	`PF16916.12`	ZT_dimer	304	380	2.2e-23	82.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L725`	Arabidopsis thaliana	Metal tolerance protein C1	60.502%	Swiss-Prot	strong database homology
`Q10LJ2`	Oryza sativa subsp. japonica	Metal tolerance protein 2	70.227%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card