LXL04_001003 | RubberDandelionOmics

Gene overview

LXL04_001003

Reference: OH-1004 Chr: Chr01 Coordinates: 18342781-18343829 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

906 bp · LXL04_001003|LXL04_001003|OH1004|cDNA

ATGGCTTCTTCGATGCTCTATGAAACTCACCATGGTAATTCATCAACCCCAAAAGGGTCTGTAGCAAGGCCAGCTTCAAAGCCTCGATTCATTCAGCACAAAAAGGAGGCATACTGGTACTACAGGTTTGTGTCAATTATTTATGATAGCTCTACAAACCTTGGCCCATGGACTGAAGATATGCGAGCCGACGCACTTGAACCGGCTGATCTCAATCGCCGTGATTTGACAGTGGTGGACGTGGGTGGCGGCACTGGGTT...

CDS

Download CDS FASTA

906 bp · LXL04_001003|LXL04_001003|OH1004|CDS

ATGGCTTCTTCGATGCTCTATGAAACTCACCATGGTAATTCATCAACCCCAAAAGGGTCTGTAGCAAGGCCAGCTTCAAAGCCTCGATTCATTCAGCACAAAAAGGAGGCATACTGGTACTACAGGTTTGTGTCAATTATTTATGATAGCTCTACAAACCTTGGCCCATGGACTGAAGATATGCGAGCCGACGCACTTGAACCGGCTGATCTCAATCGCCGTGATTTGACAGTGGTGGACGTGGGTGGCGGCACTGGGTT...

Protein

Download Protein FASTA

301 aa · LXL04_001003|LXL04_001003|OH1004|PROTEIN

MASSMLYETHHGNSSTPKGSVARPASKPRFIQHKKEAYWYYRFVSIIYDSSTNLGPWTEDMRADALEPADLNRRDLTVVDVGGGTGFATLGIVKHVDAKNVTILDQSPHQLAKAKEKEPLKECRIIEGDAEDLPFETDYADRYVSAGSIEYWPDPQRGVRESYRVLKKGGKACLIGPVYPTFWLSRFFADMWMLFPKEEEYIEWFEKAGFQDVQIKRIGPKWYRGVRRHGLIMGCSVTGVKPTSGDSPLQLGPKVEAIEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001003`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001003

Location Chr01:18342781-18343829 (+)

Description Similar to 2-methyl-6-phytyl-1,4-hydroquinone methyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63410`	Involved in a key methylation step in both tocopherols (vitamin E) and plastoquinone synthesis.	Highly divergent methyltransferases catalyze a conserved reaction in tocopherol and plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes.2003 · DOI: 10.1105/tpc.013656

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0179300`	Involved in a key methylation step in both tocopherols (vitamin E) and plastoquinone synthesis.	No verified direct reference in this release
`Os12g0615400`	Involved in a key methylation step in both tocopherols (vitamin E) and plastoquinone synthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001003 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009060 aerobic respiration Biological Process

GO:0009234 menaquinone biosynthetic process Biological Process

GO:0010189 vitamin E biosynthetic process Biological Process

GO:0010236 plastoquinone biosynthetic process Biological Process

GO:0032259 methylation Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0008425 2-methoxy-6-polyprenyl-1,4-benzoquinol methyltransferase activity Molecular Function

GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G63410

dosa:Os12g0615400

rhi:NGR_c37130

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.247

Rank 1 · LXL04_001003 · OH-1004

Golgi apparatus0.168

Rank 2 · LXL04_001003 · OH-1004

Plastid0.168

Rank 3 · LXL04_001003 · OH-1004

Cytoplasm0.138

Rank 4 · LXL04_001003 · OH-1004

Mitochondrion0.105

Rank 5 · LXL04_001003 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01209.25Ubie_methyltran70-176 aa

PF13489.13Methyltransf_2370-214 aa

PF13847.13Methyltransf_3174-177 aa

PF13649.13Methyltransf_2578-170 aa

PF08241.19Methyltransf_1179-173 aa

PF08242.19Methyltransf_1279-171 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001003	`PF01209.25`	Ubie_methyltran	70	176	8.6e-15	55.4
LXL04_001003	`PF13489.13`	Methyltransf_23	70	214	3.9e-06	27.4
LXL04_001003	`PF13847.13`	Methyltransf_31	74	177	1.2e-11	45.4
LXL04_001003	`PF13649.13`	Methyltransf_25	78	170	2.8e-17	63.9
LXL04_001003	`PF08241.19`	Methyltransf_11	79	173	6.8e-20	72.2
LXL04_001003	`PF08242.19`	Methyltransf_12	79	171	3e-10	41.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY74`	Arabidopsis thaliana	2-methyl-6-phytyl-1,4-hydroquinone methyltransferase, chloroplastic	76.667%	Swiss-Prot	strong database homology
`Q6ZLD3`	Oryza sativa subsp. japonica	2-methyl-6-phytyl-1,4-hydroquinone methyltransferase 1, chloroplastic	77.305%	Swiss-Prot	strong database homology
`Q2QM69`	Oryza sativa subsp. japonica	2-methyl-6-phytyl-1,4-hydroquinone methyltransferase 2, chloroplastic	77.061%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card