LXL04_000927 | RubberDandelionOmics

Gene overview

LXL04_000927

Reference: OH-1004 Chr: Chr01 Coordinates: 16706648-16707652 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1005 bp · LXL04_000927|LXL04_000927|OH1004|cDNA

ATGACTGAATCCCCCAAAAAGCATCAAAAACCTTCAAATTTCAACATGTTTGTCCTCCGTAAAACCCTAAAACCATCGTCTGTATTCACTACAATCCACCGGTCCATAGCCACTATTAAACCCACCGAACCACCGACCTCCGCCGCGTACGACGACCTAATCGCCAGTGCCGGTCACGAACGAGACTTCGCCACCGTCCGCCACTTCCTAAATCAACGTCACGCCAAAGGTTGCTTCAACACCAACACCACATTCAAGTT...

CDS

Download CDS FASTA

1005 bp · LXL04_000927|LXL04_000927|OH1004|CDS

ATGACTGAATCCCCCAAAAAGCATCAAAAACCTTCAAATTTCAACATGTTTGTCCTCCGTAAAACCCTAAAACCATCGTCTGTATTCACTACAATCCACCGGTCCATAGCCACTATTAAACCCACCGAACCACCGACCTCCGCCGCGTACGACGACCTAATCGCCAGTGCCGGTCACGAACGAGACTTCGCCACCGTCCGCCACTTCCTAAATCAACGTCACGCCAAAGGTTGCTTCAACACCAACACCACATTCAAGTT...

Protein

Download Protein FASTA

334 aa · LXL04_000927|LXL04_000927|OH1004|PROTEIN

MTESPKKHQKPSNFNMFVLRKTLKPSSVFTTIHRSIATIKPTEPPTSAAYDDLIASAGHERDFATVRHFLNQRHAKGCFNTNTTFKFISKDLSVLDDLLETLSTLNEGHCRKSAYDSLISWLCKIKLTDAALQVADKAIRGKYGADASTFHPLLSVLTRKKNFDEAWRVIEIMKSNRIPRDITSYNFFLTSYSVTGNLSPCVDVLRKMGEEGLKADARTYDALVLGACKAGKMNGAMAILRRMLDDGVEAMYSTYAHVIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000927`
TK1151 ID	TkA01G575730
OH-1004 ID	LXL04_000927
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.300
Protein coverage (%)	TK1151 100.000 / OH-1004 95.509 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000927

Location Chr01:16706648-16707652 (-)

Description Similar to At2g40240: Pentatricopeptide repeat-containing protein At2g40240, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40240`	Pentatricopeptide repeat-containing protein At2g40240, mitochondrial.	No verified direct reference in this release
`At3g56030`	Pentatricopeptide repeat-containing protein At3g56030, mitochondrial.	No verified direct reference in this release
`At3g07290`	Pentatricopeptide repeat-containing protein At3g07290, mitochondrial.	No verified direct reference in this release
`At4g11690`	Pentatricopeptide repeat-containing protein At4g11690.	No verified direct reference in this release
`At3g04760`	Pentatricopeptide repeat-containing protein At3g04760, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000927 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G40240

ath:AT3G07290

ath:AT3G56030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.864

Rank 1 · LXL04_000927 · OH-1004

Plastid0.077

Rank 2 · LXL04_000927 · OH-1004

Nucleus0.048

Rank 3 · LXL04_000927 · OH-1004

Cytoplasm0.031

Rank 4 · LXL04_000927 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_000927 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17177.11PPR_long129-254 aa

PF13041.13PPR_2146-192 aa

PF13041.13PPR_2181-229 aa

PF13812.13PPR_3204-260 aa

PF12854.14PPR_1212-243 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000927	`PF17177.11`	PPR_long	129	254	3.8e-08	33.7
LXL04_000927	`PF13041.13`	PPR_2	146	192	1.4e-21	77.0
LXL04_000927	`PF13041.13`	PPR_2	181	229	1.4e-21	77.0
LXL04_000927	`PF13812.13`	PPR_3	204	260	1.6e-11	44.8
LXL04_000927	`PF12854.14`	PPR_1	212	243	5.5e-13	49.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S733`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g40240, mitochondrial	47.256%	Swiss-Prot	moderate database homology
`Q9LY43`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g56030, mitochondrial	44.807%	Swiss-Prot	moderate database homology
`Q9SFV9`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g07290, mitochondrial	28.182%	Swiss-Prot	weak database homology
`Q9T0D6`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g11690	24.880%	Swiss-Prot	weak database homology
`Q9SR00`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g04760, chloroplastic	21.908%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card