LXL04_000890 | RubberDandelionOmics

Gene overview

LXL04_000890

Reference: OH-1004 Chr: Chr01 Coordinates: 16339431-16342053 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1200 bp · LXL04_000890|LXL04_000890|OH1004|cDNA

ATGCAGACGATTTCGAGAAGATTAGCTCGTGAATCCTTCACTCGGCCGGCGATTTACTCTCTCAAATCGCTTTACCCTATTTCCGATCAGTATTATGGTGCTCATGAGCGGCGGTACGCTTCTACGCTTTCTACTAAAGGTATCGGCCATTTGGTCCGGAAGGGTACTGGTGGAAGATCATCCGTTAGTGGCATAGTTGCTACAGTGTTTGGAGCTACTGGCTTCCTAGGTCGTTACTTGGTGCAAGAACTTGCTAAAAC...

CDS

Download CDS FASTA

1200 bp · LXL04_000890|LXL04_000890|OH1004|CDS

ATGCAGACGATTTCGAGAAGATTAGCTCGTGAATCCTTCACTCGGCCGGCGATTTACTCTCTCAAATCGCTTTACCCTATTTCCGATCAGTATTATGGTGCTCATGAGCGGCGGTACGCTTCTACGCTTTCTACTAAAGGTATCGGCCATTTGGTCCGGAAGGGTACTGGTGGAAGATCATCCGTTAGTGGCATAGTTGCTACAGTGTTTGGAGCTACTGGCTTCCTAGGTCGTTACTTGGTGCAAGAACTTGCTAAAAC...

Protein

Download Protein FASTA

399 aa · LXL04_000890|LXL04_000890|OH1004|PROTEIN

MQTISRRLARESFTRPAIYSLKSLYPISDQYYGAHERRYASTLSTKGIGHLVRKGTGGRSSVSGIVATVFGATGFLGRYLVQELAKTGSQVLVPFRGSEDSPRHLKLMGDLGQIVPMKYNPRDENSIKAVMAKANVVINLIGREYETRNYSFEQVNHRMAEQLATLSKEHGGIMRFIQLSCLGASQSSPSRMLQAKAAAEESIFRELPEATILRPAVMLGTEDRILNPWAQFAKKYNFLPLIGNGSTKIQPVYVADVASA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000890`
TK1151 ID	TkA01G578490
OH-1004 ID	LXL04_000890
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.681 / OH-1004 78.195 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000890

Location Chr01:16339431-16342053 (+)

Description Similar to At2g20360: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20360`	Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000890 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009749 response to glucose Biological Process

GO:0022904 respiratory electron transport chain Biological Process

GO:0042776 proton motive force-driven mitochondrial ATP synthesis Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0045271 respiratory chain complex I Cellular Component

GO:0003954 NADH dehydrogenase activity Molecular Function

KEGG gene cross-reference

ath:AT2G20360

bta:404188

ddi:DDB_G0272266

mmu:66108

rno:362440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.962

Rank 1 · LXL04_000890 · OH-1004

Cytoplasm0.060

Rank 2 · LXL04_000890 · OH-1004

Nucleus0.060

Rank 3 · LXL04_000890 · OH-1004

Cell membrane0.039

Rank 4 · LXL04_000890 · OH-1004

Endoplasmic reticulum0.014

Rank 5 · LXL04_000890 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01370.28Epimerase68-279 aa

PF05368.20NmrA68-320 aa

PF13460.13NAD_binding_1071-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000890	`PF01370.28`	Epimerase	68	279	4.5e-14	53.2
LXL04_000890	`PF05368.20`	NmrA	68	320	9.8e-12	45.8
LXL04_000890	`PF13460.13`	NAD_binding_10	71	267	2.9e-10	41.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SK66`	Arabidopsis thaliana	NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial	73.418%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card