LXL04_000711 | RubberDandelionOmics

Gene overview

LXL04_000711

Reference: OH-1004 Chr: Chr01 Coordinates: 13045432-13049341 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1698 bp · LXL04_000711|LXL04_000711|OH1004|cDNA

ATGTCTTATGTGCCTCCTCACCTCCGTAAGTCAATCGCCGCCACCACTaccacaaccaccaccaccaccaccacaaccGCCACCCCCACAAACCTAGAAAACATCCCAACAAACCACAAACTGAACTCTAAATCCAACAACAATGCGTTTTCTAATTCAACTCCTAGACGGAGCTCAGCCAACAACCACATCCAGCCGTCGAGAGCTCTCGCTGTTCCTAACGTAGTGTTTCCTCAATGGAAGCCTTCCGAACGCGTTCT...

CDS

Download CDS FASTA

1698 bp · LXL04_000711|LXL04_000711|OH1004|CDS

ATGTCTTATGTGCCTCCTCACCTCCGTAAGTCAATCGCCGCCACCACTACCACAACCACCACCACCACCACCACAACCGCCACCCCCACAAACCTAGAAAACATCCCAACAAACCACAAACTGAACTCTAAATCCAACAACAATGCGTTTTCTAATTCAACTCCTAGACGGAGCTCAGCCAACAACCACATCCAGCCGTCGAGAGCTCTCGCTGTTCCTAACGTAGTGTTTCCTCAATGGAAGCCTTCCGAACGCGTTCT...

Protein

Download Protein FASTA

565 aa · LXL04_000711|LXL04_000711|OH1004|PROTEIN

MSYVPPHLRKSIAATTTTTTTTTTTTATPTNLENIPTNHKLNSKSNNNAFSNSTPRRSSANNHIQPSRALAVPNVVFPQWKPSERVLRLKPEQIEEVRLRLNVDVTVTPDSPTAPAPIESFTDMCLDSSIMKDIAIHEYTTPTSIQAQAMPVALSGRDLLGCAETGSGKTAAFTIPMIQHCIAQVPVRRGDGPLALVLAPTRELAQQIEKEVKAFSQSLESFRTAIVVGGTNIADQRSELRTGVDIVVATPGRFIDHLQQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000711`
TK1151 ID	TkA01G592680
OH-1004 ID	LXL04_000711
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000711

Location Chr01:13045432-13049341 (+)

Description Similar to DBP2: ATP-dependent RNA helicase DBP2 (Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM 1990 / NBRC 0083 / IGC 2968)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0602400`	DEAD-box ATP-dependent RNA helicase 52A.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000711 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0000380 alternative mRNA splicing, via spliceosome Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006369 termination of RNA polymerase II transcription Biological Process

GO:0071042 nuclear polyadenylation-dependent mRNA catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0002151 G-quadruplex RNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ago:AGOS_AFL221C

cgr:2890547

dha:DEHA2A12958g

dosa:Os06g0602400

kla:KLLA0_F23716g

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.541

Rank 1 · LXL04_000711 · OH-1004

Cytoplasm0.504

Rank 2 · LXL04_000711 · OH-1004

Mitochondrion0.049

Rank 3 · LXL04_000711 · OH-1004

Endoplasmic reticulum0.041

Rank 4 · LXL04_000711 · OH-1004

Cell membrane0.033

Rank 5 · LXL04_000711 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD143-313 aa

PF04851.22ResIII163-308 aa

PF00271.38Helicase_C368-467 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000711	`PF00270.36`	DEAD	143	313	4e-52	177.0
LXL04_000711	`PF04851.22`	ResIII	163	308	1.3e-08	35.6
LXL04_000711	`PF00271.38`	Helicase_C	368	467	1.5e-31	109.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0DB53`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 52A	47.959%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card