RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_000482
Reference: OH-1004 Chr: Chr01 Coordinates: 8801860-8805038 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1206 bp · LXL04_000482|LXL04_000482|OH1004|cDNA

ATGGGTTGTTTCCCTTGCGCTGGGGGAGATTCTTCTACAAAAAGATCATCGAAGAACAAGAGAAACGACCACACCCACAACAATCAATCAAACACAATAACTTCTGATACGATAAAAGTTGAAAAGTGTAATGAAGTGAAGAAGGAAAGTGGACAGGATGTCATTCAATCATCAACTATTAATGAGAGTAAGATCCAAAGAGAGACAGGTTCTATAAACCAAGCAAGAACATTCACATATGCACAGTTAGTCAACGCCAC...

CDS

Download CDS FASTA

1206 bp · LXL04_000482|LXL04_000482|OH1004|CDS

ATGGGTTGTTTCCCTTGCGCTGGGGGAGATTCTTCTACAAAAAGATCATCGAAGAACAAGAGAAACGACCACACCCACAACAATCAATCAAACACAATAACTTCTGATACGATAAAAGTTGAAAAGTGTAATGAAGTGAAGAAGGAAAGTGGACAGGATGTCATTCAATCATCAACTATTAATGAGAGTAAGATCCAAAGAGAGACAGGTTCTATAAACCAAGCAAGAACATTCACATATGCACAGTTAGTCAACGCCAC...

Protein

Download Protein FASTA

401 aa · LXL04_000482|LXL04_000482|OH1004|PROTEIN

MGCFPCAGGDSSTKRSSKNKRNDHTHNNQSNTITSDTIKVEKCNEVKKESGQDVIQSSTINESKIQRETGSINQARTFTYAQLVNATDNFKAVYFLGEGGFGKVYKGKLEDSDQIVAIKQLDPDGLQGIREFVVEVLTLSMADHPNLVKLIGYCAEGEQRLLVYEYMPLGSLEDHLHDIRPHRRRLDWNTRMKIAAGAARGLEYLHDKMNPPVIYRDLKGSNILLGEDYHAKLSDFGLAKVGPLGDKTHVSTRVMGTYGY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_000482
TK1151 IDTkAUNG060110
OH-1004 IDLXL04_000482
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)99.500
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_000482
LocationChr01:8801860-8805038 (+)
DescriptionSimilar to PBL5: Probable serine/threonine-protein kinase PBL5
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g07870 May be involved in plant defense signaling. No verified direct reference in this release
At5g02800 Serine/threonine-protein kinase involved in the positive regulation of brassinosteroid (BR) signaling and plant growth. No verified direct reference in this release
At5g18610 May act as a receptor-like cytoplasmic kinase in chitin-induced immune signaling.
Selective regulation of the chitin-induced defense response by the Arabidopsis receptor-like cytoplasmic kinase PBL27.2014 · DOI: 10.1111/tpj.12535
The Arabidopsis CERK1-associated kinase PBL27 connects chitin perception to MAPK activation.2016 · DOI: 10.15252/embj.201694248
At2g28590 May be involved in plant defense signaling. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os05g0372100 Functions as an immediate downstream signaling partner of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.
A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000482 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0002758 innate immune response-activating signaling pathway Biological Process
GO:0006468 protein phosphorylation Biological Process
GO:0006952 defense response Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0010183 pollen tube guidance Biological Process
GO:0043410 positive regulation of MAPK cascade Biological Process
GO:0045087 innate immune response Biological Process
GO:0045088 regulation of innate immune response Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0071323 cellular response to chitin Biological Process
GO:0071456 cellular response to hypoxia Biological Process
GO:1900150 regulation of defense response to fungus Biological Process
KEGG gene cross-reference
ath:AT1G07870
ath:AT2G28590
ath:AT5G02800
ath:AT5G18610
dosa:Os05g0372100
osa:4338592
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.747
Rank 1 · LXL04_000482 · OH-1004
Cytoplasm0.216
Rank 2 · LXL04_000482 · OH-1004
Nucleus0.189
Rank 3 · LXL04_000482 · OH-1004
Endoplasmic reticulum0.038
Rank 4 · LXL04_000482 · OH-1004
Golgi apparatus0.026
Rank 5 · LXL04_000482 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase94-357 aa
PF07714.24PK_Tyr_Ser-Thr95-303 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_000482PF00069.32Pkinase943574e-44151.7
LXL04_000482PF07714.24PK_Tyr_Ser-Thr953034e-45154.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LQQ8Arabidopsis thalianaProbable serine/threonine-protein kinase PBL564.218%Swiss-Protstrong database homology
Q0WRY5Arabidopsis thalianaProbable serine/threonine-protein kinase PBL766.754%Swiss-Protstrong database homology
Q1PDV6Arabidopsis thalianaSerine/threonine-protein kinase PBL2764.179%Swiss-Protstrong database homology
Q9SIB6Arabidopsis thalianaProbable serine/threonine-protein kinase PBL666.142%Swiss-Protstrong database homology
Q6I5Q6Oryza sativa subsp. japonicaReceptor-like cytoplasmic kinase 18574.448%Swiss-Protstrong database homology

JBrowse

View in Genome Browser