LXL04_000382 | RubberDandelionOmics

Gene overview

LXL04_000382

Reference: OH-1004 Chr: Chr01 Coordinates: 7001574-7004348 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

750 bp · LXL04_000382|LXL04_000382|OH1004|cDNA

ATGCTCAATGATCAAACACATCAAGAACAAAGCGACGATGATGATGAAAACATCAGAGAAATCCATGCTCTCACCTCCCCGCTTCCACTTCCACCACCACCAGGTCCACCGCCAGCCTACCGATCCGCATCCCTGACCAGCACCGAAAGTGAAAACTTCAGCACCATGAGTAGAGAGTTTAATGCCCTAGTCTTGGCCGGAACTGGCATGACTGGAAGCGAAATCAGCGAGATCGCCAACAATGGAAACAGTAATTTGGA...

CDS

Download CDS FASTA

750 bp · LXL04_000382|LXL04_000382|OH1004|CDS

ATGCTCAATGATCAAACACATCAAGAACAAAGCGACGATGATGATGAAAACATCAGAGAAATCCATGCTCTCACCTCCCCGCTTCCACTTCCACCACCACCAGGTCCACCGCCAGCCTACCGATCCGCATCCCTGACCAGCACCGAAAGTGAAAACTTCAGCACCATGAGTAGAGAGTTTAATGCCCTAGTCTTGGCCGGAACTGGCATGACTGGAAGCGAAATCAGCGAGATCGCCAACAATGGAAACAGTAATTTGGA...

Protein

Download Protein FASTA

249 aa · LXL04_000382|LXL04_000382|OH1004|PROTEIN

MLNDQTHQEQSDDDDENIREIHALTSPLPLPPPPGPPPAYRSASLTSTESENFSTMSREFNALVLAGTGMTGSEISEIANNGNSNLERIGEDDMRETNPLAIVADNNPIPIASPTRSLTGAMITTTGNSEVSVHRVKKDEVESKISAWQNAKISKINNRFKRDDAIINGWENEQVQKSSLWMKKVERKLEEKRARAMEKMQNDIAKARRKAEERRATAEAKRGTKTARILEVANLMRVVGRPPVKRSFF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000382`
TK1151 ID	TkA01G615910
OH-1004 ID	LXL04_000382
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000382

Location Chr01:7001574-7004348 (+)

Description Similar to REM4.2: Remorin 4.2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g41870`	Collaborates with REM4.1 to positively regulate the BCTV and BSCTV susceptibility.	No verified direct reference in this release
`At3g57540`	Collaborates with REM4.2 to positively regulate the BCTV and BSCTV susceptibility.	Arabidopsis thaliana Remorins Interact with SnRK1 and Play a Role in Susceptibility to Beet Curly Top Virus and Beet Severe Curly Top Virus.2014 · DOI: 10.5423/ppj.oa.06.2014.0061
`At5g23750`	Remorin 1.4.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0569100`	Functions in abscisic acid (ABA) signaling downstream of BZIP23.	OsREM4.1 Interacts with OsSERK1 to Coordinate the Interlinking between Abscisic Acid and Brassinosteroid Signaling in Rice.2016 · DOI: 10.1016/j.devcel.2016.06.011

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000382 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007267 cell-cell signaling Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010555 response to mannitol Biological Process

GO:1900458 negative regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT2G41870

ath:AT3G57540

ath:AT5G23750

dosa:Os07g0569100

sot:102577743

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.445

Rank 1 · LXL04_000382 · OH-1004

Cytoplasm0.352

Rank 2 · LXL04_000382 · OH-1004

Nucleus0.311

Rank 3 · LXL04_000382 · OH-1004

Plastid0.048

Rank 4 · LXL04_000382 · OH-1004

Endoplasmic reticulum0.039

Rank 5 · LXL04_000382 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03763.19Remorin_C140-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000382	`PF03763.19`	Remorin_C	140	244	4e-31	107.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93758`	Arabidopsis thaliana	Remorin 4.2	53.650%	Swiss-Prot	strong database homology
`Q93YN8`	Arabidopsis thaliana	Remorin 4.1	50.752%	Swiss-Prot	strong database homology
`Q9FFA5`	Arabidopsis thaliana	Remorin 1.4	35.593%	Swiss-Prot	weak database homology
`Q7XII4`	Oryza sativa subsp. japonica	Remorin 4.1	55.856%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card