LXL04_000315 | RubberDandelionOmics

Gene overview

LXL04_000315

Reference: OH-1004 Chr: Chr01 Coordinates: 5859165-5864070 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1956 bp · LXL04_000315|LXL04_000315|OH1004|cDNA

ATGGTACAATTTTGTTGCAAATCTGGCGATAAGCCCTTCGACATAGTGAAGCTCAAGCGGAGGCGCCGTGCAGCAGATGAATCACCGGAAACATCAATACAAATGTTGCGATCTCTCCGAGTCAAGCGATCCCTCCAATCCTTTGTCATTAACCGCAAAATTTCACATTTCGATCACACCCTCGAGCCCCTATCTTCTTTCCGCACCGCTAAAACCCCTCAAATAAACCTCATACGTCACTTTTCTTCATCATCTCCACC...

CDS

Download CDS FASTA

1956 bp · LXL04_000315|LXL04_000315|OH1004|CDS

ATGGTACAATTTTGTTGCAAATCTGGCGATAAGCCCTTCGACATAGTGAAGCTCAAGCGGAGGCGCCGTGCAGCAGATGAATCACCGGAAACATCAATACAAATGTTGCGATCTCTCCGAGTCAAGCGATCCCTCCAATCCTTTGTCATTAACCGCAAAATTTCACATTTCGATCACACCCTCGAGCCCCTATCTTCTTTCCGCACCGCTAAAACCCCTCAAATAAACCTCATACGTCACTTTTCTTCATCATCTCCACC...

Protein

Download Protein FASTA

651 aa · LXL04_000315|LXL04_000315|OH1004|PROTEIN

MVQFCCKSGDKPFDIVKLKRRRRAADESPETSIQMLRSLRVKRSLQSFVINRKISHFDHTLEPLSSFRTAKTPQINLIRHFSSSSPPPPTPPPLSAASSTSKELRRYLGYSALLLSCAVATYYSFPFPENAKHKKAQLFRYAPLPDDLHTVANWSGTHEVQTRVFHQPETLEELETIVKDANEKKQKIRPVGSGLSPNGIGLARGGMVNLALLDKVLEVNKEKKTVRVQAGIRVQQLVDAIKDYGITLQNFASIREQQIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000315`
TK1151 ID	TkA01G620600
OH-1004 ID	LXL04_000315
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 94.777 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000315

Location Chr01:5859165-5864070 (+)

Description Similar to L-galactono-1,4-lactone dehydrogenase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g47930`	Involved in the biosynthesis of ascorbate.	L-galactono-1,4-lactone dehydrogenase is required for the accumulation of plant respiratory complex I.2008 · DOI: 10.1074/jbc.m805320200

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0139600`	Involved in the biosynthesis of ascorbic acid.	No verified direct reference in this release
`Os11g0143500`	Involved in the biosynthesis of ascorbic acid.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000315 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019853 L-ascorbic acid biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0003885 D-arabinono-1,4-lactone oxidase activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0016633 galactonolactone dehydrogenase activity Molecular Function

GO:0050105 L-gulonolactone oxidase activity Molecular Function

GO:0050660 flavin adenine dinucleotide binding Molecular Function

GO:0071949 FAD binding Molecular Function

GO:0080049 L-gulono-1,4-lactone dehydrogenase activity Molecular Function

KEGG gene cross-reference

ag:CAB09796

ath:AT3G47930

dosa:Os11g0143500

dosa:Os12g0139600

ssc:396759

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.855

Rank 1 · LXL04_000315 · OH-1004

Cytoplasm0.091

Rank 2 · LXL04_000315 · OH-1004

Plastid0.061

Rank 3 · LXL04_000315 · OH-1004

Nucleus0.047

Rank 4 · LXL04_000315 · OH-1004

Peroxisome0.038

Rank 5 · LXL04_000315 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01565.29FAD_binding_4164-294 aa

PF04030.20ALO321-641 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000315	`PF01565.29`	FAD_binding_4	164	294	1e-27	97.2
LXL04_000315	`PF04030.20`	ALO	321	641	1.3e-18	68.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SU56`	Arabidopsis thaliana	L-galactono-1,4-lactone dehydrogenase, mitochondrial	77.049%	Swiss-Prot	strong database homology
`Q2QXY1`	Oryza sativa subsp. japonica	L-galactono-1,4-lactone dehydrogenase 2, mitochondrial	69.352%	Swiss-Prot	strong database homology
`Q2RAP0`	Oryza sativa subsp. japonica	L-galactono-1,4-lactone dehydrogenase 1, mitochondrial	70.053%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card