TkA08G158470 | RubberDandelionOmics

Gene overview

TkA08G158470

Reference: TK1151 Chr: Chr08 Coordinates: 41260742-41264399 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2908 bp · TkA08G158470|TK1151|cDNA

AAAAACATAAAATAATCGAACACAATCTCTCACTCACACCGCTCTCACCTCTTTACACACACTCTCCCCTTCTCTCTCTCTCTCTCTTGCTCTGTTCTTCTGTTTTTGGCAAAAAGATACCAAAAGGTACGCCTATTCTCGTTCCGAATCAAACCCATCAGCGGTTTTTTTCTTCAATCGCCATCATTCTATCACACCCACTGCAGTAACGCTAGCAAAAACAGCCGTTTGATTTGATTATGAAAATCTAAAGTAACTCG...

CDS

Download CDS FASTA

1737 bp · TkA08G158470|TK1151|CDS

ATGGGGAGTTCTTATGAAGCAAACGGCAAAACTATTGACTCAACCGTGGGCGGGTTGGTTTGGGTCCGCCGTAGAAACGGATCGTGGTGGCCGGGTCGCATATTGGGGCCTGATGAGTTACCGGAAAGCTGCCTGGTTTCCCCGAGATCAGGTACTCCGGTGAAGCTACTAGGAAGAGAAGATGCAAGTGTGGATTGGTACAATCTTGAAAAATCCAAACGAGTAAAATCCTTCCGATGTGGCGAATACGACGAATGCAT...

Protein

Download Protein FASTA

578 aa · TkA08G158470|TK1151|PROTEIN

MGSSYEANGKTIDSTVGGLVWVRRRNGSWWPGRILGPDELPESCLVSPRSGTPVKLLGREDASVDWYNLEKSKRVKSFRCGEYDECIEKAKASASISCKKAVKYARKEDAILHALELESSRVPKNSPENEATSDKLSGLEYISNSPPEPELEPEPELELECVPPHDSEEDGIEGSKKRMRGLKDIGISGTFKRRRSQVAHVHEFLKKKNRRRQLTKVLKSTAMVTVPVMCEQLTGSVPYLPDNKASGSFSVVINNNSDST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G158470`
TK1151 ID	TkA08G158470
OH-1004 ID	LXL04_032173
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G158470

Location Chr08:41260742-41264399 (+)

Description Similar to At1g51745: Uncharacterized protein At1g51745

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51745`	Uncharacterized protein At1g51745.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032173 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0032991 protein-containing complex Cellular Component

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA08G158470 · TK1151

Cytoplasm0.067

Rank 2 · TkA08G158470 · TK1151

Cell membrane0.028

Rank 3 · TkA08G158470 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA08G158470 · TK1151

Plastid0.013

Rank 5 · TkA08G158470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00855PWWP18-107 aa

PF05887Trypan_PARP116-163 aa

PF23610VWA7_4198-223 aa

PF05887Trypan_PARP373-396 aa

PF23610VWA7_4441-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G158470	`PF00855`	PWWP	18	107	4.4e-13	50.3
TkA08G158470	`PF05887`	Trypan_PARP	116	163	9.3	7.0
TkA08G158470	`PF23610`	VWA7_4	198	223	0.18	13.0
TkA08G158470	`PF05887`	Trypan_PARP	373	396	9.3	7.0
TkA08G158470	`PF23610`	VWA7_4	441	522	0.18	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P59278`	Arabidopsis thaliana	sp\|P59278\|Y1745_ARATH Uncharacterized protein At1g51745	34.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card