TkA08G106930 | RubberDandelionOmics

Gene overview

TkA08G106930

Reference: TK1151 Chr: Chr08 Coordinates: 27836309-27839502 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1831 bp · TkA08G106930|TK1151|cDNA

ATGATTGATTTATGTACAAACCGTGAATGGATATCCTTAGGATCATGTGATTGGAGTCGTTATGACACCTCTTTTGTTACAAGTTTGTTACTTCAACAAGCATACGATCGCCAGCCGTACGTTCCGGCCATTCTCCGGAAACTGATCCGTTTAGCTTTATCTCACTTTCTATATTGTATAGGAATCCGATGTTTGAAATCGTTCCCTGGCACGATGAGTCAGGTATTCGACGGATATGAGCGTCAATACTGCGAGATTTC...

CDS

Download CDS FASTA

873 bp · TkA08G106930|TK1151|CDS

ATGATTGATTTATGTACAAACCGTGAATGGATATCCTTAGGATCATGTGATTGGAGTCGTTATGACACCTCTTTTGTTACAAGTTTGTTACTTCAACAAGCATACGATCGCCAGCCGTACGTTCCGGCCATTCTCCGGAAACTGATCCGTTTAGCTTTATCTCACTTTCTATATTGTATAGGAATCCGATGTTTGAAATCGTTCCCTGGCACGATGAGTCAGGTATTCGACGGATATGAGCGTCAATACTGCGAGATTTC...

Protein

Download Protein FASTA

290 aa · TkA08G106930|TK1151|PROTEIN

MIDLCTNREWISLGSCDWSRYDTSFVTSLLLQQAYDRQPYVPAILRKLIRLALSHFLYCIGIRCLKSFPGTMSQVFDGYERQYCEISANLSHLCTSASVADGEQKKQKVSEIAEGIDEADALLRKMDLEARSMPAGIKASLLAKIREYRNDLNTLKTEMKKLNSTNPSARDDLLESGRPDSMQVSADQRGRLMMSTERLNKSTDRVKESRRAMMETEELGVSILHDLHQQRQSLLHANNTLHGVDDSIGRGKKILTNMSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G106930`
TK1151 ID	TkA08G106930
OH-1004 ID	LXL04_031441
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.100
Protein coverage (%)	TK1151 77.931 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G106930

Location Chr08:27836309-27839502 (-)

Description Similar to VTI13: Vesicle transport v-SNARE 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g29100`	May function as a v-SNARE responsible for targeting vesicles involved in the secretory pathway (By similarity).	SNARE VTI13 plays a unique role in endosomal trafficking pathways associated with the vacuole and is essential for cell wall organization and root hair growth in arabidopsis.2014 · DOI: 10.1093/aob/mcu041
`At5g39510`	Functions as a v-SNARE responsible for targeting AtELP-containing vesicles from the trans-Golgi network (TGN) to the prevacuolar compartment (PVC) and mediates liposome fusion.	The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment.1999 · DOI: 10.1091/mbc.10.7.2251 SGR2, a phospholipase-like protein, and ZIG/SGR4, a SNARE, are involved in the shoot gravitropism of Arabidopsis.2002 · DOI: 10.1105/tpc.010215 Involvement of the vacuoles of the endodermis in the early process of shoot gravitropism in Arabidopsis.2002 · DOI: 10.1105/tpc.010216 Conversion of functional specificity in Qb-SNARE VTI1 homologues of Arabidopsis.2005 · DOI: 10.1016/j.cub.2005.02.021 Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis.2007 · DOI: 10.1073/pnas.0611147104 The occurrence of 'bulbs', a complex configuration of the vacuolar membrane, is affected by mutations of vacuolar SNARE and phospholipase in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2011.04665.x Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22 Mutations in the SGR4, SGR5 and SGR6 loci of Arabidopsis thaliana alter the shoot gravitropism.1997 · DOI: 10.1093/oxfordjournals.pcp.a029201
`At1g26670`	Together with either SYP41 or SYP61, required for membrane fusion; the fusion of phospholipid vesicles containing SYP41 or SYP61 and VTI12 is triggered by YKT61 and YKT62.	Conversion of functional specificity in Qb-SNARE VTI1 homologues of Arabidopsis.2005 · DOI: 10.1016/j.cub.2005.02.021 YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061 Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis.2007 · DOI: 10.1073/pnas.0611147104 Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031441 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0006914 autophagy Biological Process

GO:0009630 gravitropism Biological Process

GO:0009664 plant-type cell wall organization Biological Process

GO:0016189 synaptic vesicle to endosome fusion Biological Process

GO:0016236 macroautophagy Biological Process

GO:0032456 endocytic recycling Biological Process

KEGG gene cross-reference

ath:AT1G26670

ath:AT3G29100

ath:AT5G39510

hsa:143187

mmu:53611

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.502

Rank 1 · TkA08G106930 · TK1151

Endoplasmic reticulum0.264

Rank 2 · TkA08G106930 · TK1151

Cytoplasm0.215

Rank 3 · TkA08G106930 · TK1151

Lysosome / Vacuole0.142

Rank 4 · TkA08G106930 · TK1151

Cell membrane0.097

Rank 5 · TkA08G106930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01757Acyl_transf_329-74 aa

PF03908Sec2046-60 aa

PF05008V-SNARE72-162 aa

PF27021BOS1_GOSR2_MEM11-like_N72-173 aa

PF24915Spectrin_SESTD190-128 aa

PF10595FAM161A_B96-215 aa

PF07926TPR_MLP1_2103-124 aa

PF02601Exonuc_VII_L103-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G106930	`PF01757`	Acyl_transf_3	29	74	0.18	11.6
TkA08G106930	`PF03908`	Sec20	46	60	1.8e-08	34.9
TkA08G106930	`PF05008`	V-SNARE	72	162	4.3e-30	104.7
TkA08G106930	`PF27021`	BOS1_GOSR2_MEM11-like_N	72	173	0.0048	17.9
TkA08G106930	`PF24915`	Spectrin_SESTD1	90	128	3.1	8.9
TkA08G106930	`PF10595`	FAM161A_B	96	215	0.1	12.3
TkA08G106930	`PF07926`	TPR_MLP1_2	103	124	0.24	12.1
TkA08G106930	`PF02601`	Exonuc_VII_L	103	241	2.1	8.4
TkA08G106930	`PF12352`	V-SNARE_C	106	127	2.2e-21	76.6
TkA08G106930	`PF00435`	Spectrin	106	188	0.0089	17.2
TkA08G106930	`PF14362`	DUF4407	123	289	0.056	13.4
TkA08G106930	`PF03908`	Sec20	137	164	1.8e-08	34.9
TkA08G106930	`PF07926`	TPR_MLP1_2	139	176	0.24	12.1
TkA08G106930	`PF13997`	YqjK	141	149	0.066	14.4
TkA08G106930	`PF19012`	DUF5741	144	160	0.017	15.7
TkA08G106930	`PF12352`	V-SNARE_C	149	164	2.2e-21	76.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVP9`	Arabidopsis thaliana	sp\|Q9LVP9\|VTI13_ARATH Vesicle transport v-SNARE 13	64.700%	Swiss-Prot	High
`Q9SEL6`	Arabidopsis thaliana	sp\|Q9SEL6\|VTI11_ARATH Vesicle transport v-SNARE 11	64.300%	Swiss-Prot	High
`Q9SEL5`	Arabidopsis thaliana	sp\|Q9SEL5\|VTI12_ARATH Vesicle transport v-SNARE 12	64.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card