RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G426320
Reference: TK1151 Chr: Chr07 Coordinates: 107788332-107792545 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2137 bp · TkA07G426320|TK1151|cDNA

AAAGAAACCACAGGGGCCATTTCCAGAAAATCTACATAATAGATAGAGTGGCTCGCCTGCGCCACGTCATCAATGGCACAATGCGCACAGACGGCGCTTTTTAGCACGGCTATATATTCCAGAGTCAAAAACAAGACGACAAATTCACATTCGTGGCTAACGAGAATCCAAACTCAATTTCGGAGAAAATCAAGTGGATAAGAATAATTTGAAGCAGATTCAGTTACATTCGTTACAAATTCCCGTAGAATTCTCCGATC...

CDS

Download CDS FASTA

1509 bp · TkA07G426320|TK1151|CDS

ATGAGTTCCACGGCAACCTCCTCCTCCTCCTCACCTCTCGACTGGAAATTCTCTCAGGTTTTCGGCGAACGTCGTCCCGGCGAAGACGTCGATAACATTGATGTGATATCTGCTATTGAATTTGATAAGAGCGGTGATTATCTTGCTGTCGGCGATCGAGGAGGACGTGTTGTGATTTTCGAAACAAAGGTAACAAGTAAGCAACATTTGCATAATGCGACAGAAGGATCGGATGATGTCATACAACATCCCGAGTATAG...

Protein

Download Protein FASTA

502 aa · TkA07G426320|TK1151|PROTEIN

MSSTATSSSSSPLDWKFSQVFGERRPGEDVDNIDVISAIEFDKSGDYLAVGDRGGRVVIFETKVTSKQHLHNATEGSDDVIQHPEYRYKTEFQSHEPEFDYLKSVEIEEKINKLKWCTTLNGSLFMLSTNDKTIKLWKIKERKVKKVKEMDLTPYVSSESALLSESSFLSHESKSSISNGHRLEWTDNMKPSISPSSMNGENIGDGAIARCRKMYGHAHDYNINSISNNSDGETFISSDDLRINLWNLEVSDQCFNIIDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G426320
TK1151 IDTkA07G426320
OH-1004 IDLXL04_030728
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G426320
LocationChr07:107788332-107792545 (+)
DescriptionSimilar to PP2AB2: Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B beta isoform
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g17720 The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment. No verified direct reference in this release
At1g51690 The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: A2X2K3 The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment. No verified direct reference in this release
Os02g0224200 The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment. No verified direct reference in this release
Os06g0563300 The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_030728 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006470 protein dephosphorylation Biological Process
GO:0000159 protein phosphatase type 2A complex Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0019888 protein phosphatase regulator activity Molecular Function
KEGG gene cross-reference
ath:AT1G17720
ath:AT1G51690
dosa:Os02g0224200
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.573
Rank 1 · TkA07G426320 · TK1151
Cytoplasm0.384
Rank 2 · TkA07G426320 · TK1151
Lysosome / Vacuole0.076
Rank 3 · TkA07G426320 · TK1151
Cell membrane0.052
Rank 4 · TkA07G426320 · TK1151
Golgi apparatus0.039
Rank 5 · TkA07G426320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24782WD40_MABP1-WDR62_2nd27-69 aa
PF24796WDR5530-72 aa
PF23098Beta-prop_NOL10_N31-138 aa
PF24807WD40_CDC20-Fz33-72 aa
PF23775Beta-prop_RIG_2nd33-72 aa
PF23383Beta-prop_IFT140_1st33-69 aa
PF24814WD40_Prp1934-77 aa
PF24817WD40_WDHD1_1st34-65 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G426320PF24782WD40_MABP1-WDR62_2nd27691.7e-0524.7
TkA07G426320PF24796WDR5530729e-0935.5
TkA07G426320PF23098Beta-prop_NOL10_N311384.5e-0730.1
TkA07G426320PF24807WD40_CDC20-Fz33721e-0732.3
TkA07G426320PF23775Beta-prop_RIG_2nd33721.1e-0525.7
TkA07G426320PF23383Beta-prop_IFT140_1st33690.0002420.7
TkA07G426320PF24814WD40_Prp1934773.1e-1453.4
TkA07G426320PF24817WD40_WDHD1_1st34652.2e-0731.1
TkA07G426320PF12894ANAPC4_WD4034791e-0526.4
TkA07G426320PF23414Beta-prop_EML_234741.3e-0525.4
TkA07G426320PF23414Beta-prop_EML_234831.3e-0525.4
TkA07G426320PF23389Beta-prop_WDR19_1st34670.00118.9
TkA07G426320PF23410Beta-prop_VPS834750.03114.0
TkA07G426320PF25175Beta-prop_WDR535812.9e-1247.2
TkA07G426320PF00400WD4036601.5e-1351.3
TkA07G426320PF25174Beta-prop_THOC336841.6e-1351.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q39247Arabidopsis thalianasp|Q39247|2ABB_ARATH Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B beta isoform55.400%Swiss-ProtHigh
Q38821Arabidopsis thalianasp|Q38821|2ABA_ARATH Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform54.300%Swiss-ProtHigh
A2X2K3Oryza sativa subsp. indicasp|A2X2K3|2ABB_ORYSI Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B beta isoform56.200%Swiss-ProtHigh
Q0E2P1Oryza sativa subsp. japonicasp|Q0E2P1|2ABB_ORYSJ Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B beta isoform56.200%Swiss-ProtHigh
Q5Z8Z7Oryza sativa subsp. japonicasp|Q5Z8Z7|2ABA_ORYSJ Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform55.200%Swiss-ProtHigh

JBrowse

View in Genome Browser