TkA07G314540 | RubberDandelionOmics

Gene overview

TkA07G314540

Reference: TK1151 Chr: Chr07 Coordinates: 78904410-78906533 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1709 bp · TkA07G314540|TK1151|cDNA

CTAAAACATTCCTTTCCGTGCTTTTTTCAAGAACAGTGGAAAGTAAAAGGAGGCCATCACTCTATCTCTCTCTTCTCTCTGTCTGCTTCTTTCAGTCATGGACAGGCCTCACTGGCCACAGGTATATATCTGGATCTTTCACCTTCTGCATCACCTCCCTCACTTAATTCACAAACTTAAACGACAAGAAAAGTTGTATTATTTCATTTCCTTTCGTTCATGATCATATGAAAGAAACCTAGCTAAAAGTTTTGAATATG...

CDS

Download CDS FASTA

918 bp · TkA07G314540|TK1151|CDS

ATGGACAGGCCTCACTGGCCACAGGAGATAGTGGTGAAGCCAATGGAACAAATAGTAGTACCCAACACCAACACAATCACCAACACCAACACCACAAACTCAAATAACAATTTTAACAATCTCTCAAAGCCATCTTCAAGCTCTTCCTCTTTTGAAAGAAGGCTAAGACCACAAAAAGCTGCCGCCGTCAACTGTCCGAGGTGCGATTCCACCAACACCAAGTTTTGTTACTACAACAATTACAGTCTTTCTCAACCACG...

Protein

Download Protein FASTA

305 aa · TkA07G314540|TK1151|PROTEIN

MDRPHWPQEIVVKPMEQIVVPNTNTITNTNTTNSNNNFNNLSKPSSSSSSFERRLRPQKAAAVNCPRCDSTNTKFCYYNNYSLSQPRYFCKTCRRYWTEGGTLRNIPVGGGSRKNKRSSSSSSTTSSSQTSVSKKLSDLVVPSASTSVLSGNPRIHHDRYGQDLNLGNTNSSASTTTSASLSAMELLTGITARGTTNNCLMPIPIADPNSVYSQSAQLMIPMPEFKIPTSLSFSLDGMATGGGGGGGGGGGTYGNTLHDR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G314540`
TK1151 ID	TkA07G314540
OH-1004 ID	LXL04_029472
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	85.500
Protein coverage (%)	TK1151 94.754 / OH-1004 83.882 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G314540

Location Chr07:78904410-78906533 (-)

Description Similar to DOF4.6: Dof zinc finger protein DOF4.6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g24060`	Transcription factor that binds specifically to a 5'-AA[AG]G-3' consensus core sequence.	No verified direct reference in this release
`At1g64620`	Transcription factor that binds specifically to a 5'-AA[AG]G-3' consensus core sequence.	No verified direct reference in this release
`At3g61850`	Transcription factor specifically involved in the maternal control of seed germination.	No verified direct reference in this release
`At2g46590`	Transcription factor specifically involved in the maternal control of seed germination.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0673700`	Transcription factor that may transactivate seed storage protein genes in developing seeds.	No verified direct reference in this release
`Os04g0567800`	Transcription factor that may transactivate seed storage protein genes in developing seeds.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029472 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009845 seed germination Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003682 chromatin binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G64620

ath:AT3G61850

ath:AT4G24060

dosa:Os02g0673700

dosa:Os04g0567800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · TkA07G314540 · TK1151

Cytoplasm0.094

Rank 2 · TkA07G314540 · TK1151

Cell membrane0.024

Rank 3 · TkA07G314540 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA07G314540 · TK1151

Plastid0.011

Rank 5 · TkA07G314540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25545DUF79249-58 aa

PF12251SNAPC345-95 aa

PF14369Zn_ribbon_1954-70 aa

PF23451Zn_ribbon_PaaD58-94 aa

PF02701Zn_ribbon_Dof62-117 aa

PF12760Zn_ribbon_IS159562-95 aa

PF27208TP_021465-95 aa

PF14369Zn_ribbon_1987-98 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G314540	`PF25545`	DUF7924	9	58	0.018	15.3
TkA07G314540	`PF12251`	SNAPC3	45	95	0.19	12.1
TkA07G314540	`PF14369`	Zn_ribbon_19	54	70	0.25	12.3
TkA07G314540	`PF23451`	Zn_ribbon_PaaD	58	94	0.00016	22.0
TkA07G314540	`PF02701`	Zn_ribbon_Dof	62	117	2.3e-34	118.0
TkA07G314540	`PF12760`	Zn_ribbon_IS1595	62	95	2.6	8.8
TkA07G314540	`PF27208`	TP_0214	65	95	0.048	14.1
TkA07G314540	`PF14369`	Zn_ribbon_19	87	98	0.25	12.3
TkA07G314540	`PF25545`	DUF7924	123	171	0.018	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LAP8`	Arabidopsis thaliana	sp\|Q8LAP8\|DOF46_ARATH Dof zinc finger protein DOF4.6	40.100%	Swiss-Prot	Medium
`Q84JQ8`	Arabidopsis thaliana	sp\|Q84JQ8\|DOF18_ARATH Dof zinc finger protein DOF1.8	60.000%	Swiss-Prot	Low
`Q43385`	Arabidopsis thaliana	sp\|Q43385\|DOF37_ARATH Dof zinc finger protein DOF3.7	34.900%	Swiss-Prot	Medium
`Q9ZPY0`	Arabidopsis thaliana	sp\|Q9ZPY0\|DOF25_ARATH Dof zinc finger protein DOF2.5	36.300%	Swiss-Prot	Medium
`B9F1L8`	Oryza sativa subsp. japonica	sp\|B9F1L8\|DOF2_ORYSJ Dof zinc finger protein 2	42.000%	Swiss-Prot	Medium
`Q9SXG8`	Oryza sativa subsp. japonica	sp\|Q9SXG8\|DOF1_ORYSJ Dof zinc finger protein 1	58.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card