Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3288 bp · TkA06G079730|TK1151|cDNA
AAGCAATACGCTAGCTAGACATTTCGGACAAGCAATCAAAGTATGCAATCAATCGAACCAAAATGATCTGGTAATAATTGAGTATCGAGTTGAACATGTGATTATTATTACTAATTGACTAAAATGATTCGTAACAATTTAATTAGACCAGTTTAAAGTATCATACTTATTGATAACATTTTATGAATTATTGACGATAGGAAAACACAGCCAAATTGCACACACATTTTCAGATGTCTTCAACATACGCAAGAAGCTCT...
1467 bp · TkA06G079730|TK1151|CDS
ATGATAATAATTTGGAATATGGAGGAAGTCTACTTGCTTGTAACCGCCAACTATGACAAAGCTTTAGCTCTACTTCTTTCTTGGGTGGTCTTAAGTTTTCTTACCAAGAAAATTATGAGGAAATCAACGGACACCATCCCCGGACATCTTGGTCTTCCTCTAATTGGCGAAACATTTTCCTTTCTTTCATGTGCTAATAGCACCAAAGGCTGCTATGATTTTGTGCGTCTTCGGAGACTATGGCATGGAAACTGGTTCAA...
Protein
Download Protein FASTA488 aa · TkA06G079730|TK1151|PROTEIN
MIIIWNMEEVYLLVTANYDKALALLLSWVVLSFLTKKIMRKSTDTIPGHLGLPLIGETFSFLSCANSTKGCYDFVRLRRLWHGNWFKTRLFGKVHVFVPSVVGAKTILTNEFKLFNKCLVKSMADAVGKKSLLCVPVESHKRIRRLLSGPFSMESLSEFVQKFDKLLCSRFKKLSEDGKSFVVLEFSMKIAFDAMCEMLMSITDESLLAKIEQDSTAISSAMISIPVMIPGTRYYKGMKARERLMKLFEELIAGRRMGKE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G079730 |
|---|---|
| TK1151 ID | TkA06G079730 |
| OH-1004 ID | LXL04_025129 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G079730 |
|---|---|
| Location | Chr06:21385353-21390511 (-) |
| Description | Similar to CYP707A5: Abscisic acid 8'-hydroxylase 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001666 response to hypoxia Biological Process GO:0009414 response to water deprivation Biological Process GO:0009639 response to red or far red light Biological Process GO:0009687 abscisic acid metabolic process Biological Process GO:0010268 brassinosteroid homeostasis Biological Process GO:0016125 sterol metabolic process Biological Process GO:0016132 brassinosteroid biosynthetic process Biological Process GO:0046345 abscisic acid catabolic process Biological Process GO:0048838 release of seed from dormancy Biological Process GO:0050832 defense response to fungus Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:0005576 extracellular region Cellular Component |
| KEGG gene cross-reference | ag:BAG68929 ath:AT4G19230 ath:AT5G45340 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00067p45049-459 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G079730 | PF00067 | p450 | 49 | 459 | 8.5e-64 | 216.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.