TkA06G070170 | RubberDandelionOmics

Gene overview

TkA06G070170

Reference: TK1151 Chr: Chr06 Coordinates: 18802446-18803741 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1296 bp · TkA06G070170|TK1151|cDNA

ATGGTTTTCGACAACAAAAATGAGGCAGCTTCCTCCTCCAACGGCCGATCGGTTCCGAGGGAAGACTCCCCTCTTCTCGGAAACGACGATTCGTTATCATCCACGCCCAAGACCTTCGCTAACGTCTTCATCGCAATCGTCGGTGCCGGCGTTCTTGGTCTCCCTTATACATTCATGCGCACCGGTTGGGTTACTGGATTCGTCATGATCTTCGCCGTCGCCGGCCTTGCGTACCGTGGCATGATGCTCCTCATCGTAAC...

CDS

Download CDS FASTA

1296 bp · TkA06G070170|TK1151|CDS

ATGGTTTTCGACAACAAAAATGAGGCAGCTTCCTCCTCCAACGGCCGATCGGTTCCGAGGGAAGACTCCCCTCTTCTCGGAAACGACGATTCGTTATCATCCACGCCCAAGACCTTCGCTAACGTCTTCATCGCAATCGTCGGTGCCGGCGTTCTTGGTCTCCCTTATACATTCATGCGCACCGGTTGGGTTACTGGATTCGTCATGATCTTCGCCGTCGCCGGCCTTGCGTACCGTGGCATGATGCTCCTCATCGTAAC...

Protein

Download Protein FASTA

431 aa · TkA06G070170|TK1151|PROTEIN

MVFDNKNEAASSSNGRSVPREDSPLLGNDDSLSSTPKTFANVFIAIVGAGVLGLPYTFMRTGWVTGFVMIFAVAGLAYRGMMLLIVTRRKLESPLTYSKINSFGDLGFAVCGPIGRLAVDLMIIASQAGFCVGYLIFIGNTLANLFHATPTESPNYLNATAYIWGMKAKTFYVWSCFPFQLGLNAIPTLTLLAPLSIFADIVDVGAMGVVMVEDVTVFMKKTTEVHAFGTFPMFCYGLGVALFSFEGIGMALPLESEAKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G070170`
TK1151 ID	TkA06G070170
OH-1004 ID	LXL04_025280
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G070170

Location Chr06:18802446-18803741 (-)

Description Similar to AVT3B: Amino acid transporter AVT3B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g42005`	Translocates preferentially neutral amino acids from the vacuole to the cytoplasm.	No verified direct reference in this release
`At4g38250`	Translocates preferentially neutral amino acids from the vacuole to the cytoplasm.	No verified direct reference in this release
`At5g65990`	Translocates preferentially neutral amino acids and to a lesser extent aromatic amino acids from the vacuole to the cytoplasm.	Functional identification of AtAVT3, a family of vacuolar amino acid transporters, in Arabidopsis.2017 · DOI: 10.1002/1873-3468.12507
`At3g11900`	Translocates aromatic and neutral amino acids such as tyrosine, tryptophan, phenylalanine, histidine, proline, leucine, valine, glutamine, as well as arginine.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025280 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003333 amino acid transmembrane transport Biological Process

GO:0006865 amino acid transport Biological Process

GO:0009624 response to nematode Biological Process

GO:0015734 taurine transmembrane transport Biological Process

GO:0015801 aromatic amino acid transport Biological Process

GO:0015804 neutral amino acid transport Biological Process

GO:0015808 L-alanine transport Biological Process

GO:0015816 glycine transport Biological Process

GO:0032328 alanine transport Biological Process

GO:0035524 proline transmembrane transport Biological Process

GO:0089718 amino acid import across plasma membrane Biological Process

GO:1902600 proton transmembrane transport Biological Process

KEGG gene cross-reference

ath:AT2G42005

ath:AT3G11900

ath:AT4G38250

ath:AT5G65990

hsa:206358

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.391

Rank 1 · TkA06G070170 · TK1151

Lysosome / Vacuole0.314

Rank 2 · TkA06G070170 · TK1151

Cytoplasm0.147

Rank 3 · TkA06G070170 · TK1151

Endoplasmic reticulum0.109

Rank 4 · TkA06G070170 · TK1151

Golgi apparatus0.090

Rank 5 · TkA06G070170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01490Aa_trans33-424 aa

PF11947DUF346440-63 aa

PF11947DUF346467-112 aa

PF11947DUF3464240-271 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G070170	`PF01490`	Aa_trans	33	424	1.8e-70	238.4
TkA06G070170	`PF11947`	DUF3464	40	63	6.8	7.2
TkA06G070170	`PF11947`	DUF3464	67	112	6.8	7.2
TkA06G070170	`PF11947`	DUF3464	240	271	6.8	7.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4ILY9`	Arabidopsis thaliana	sp\|F4ILY9\|AVT3B_ARATH Amino acid transporter AVT3B	64.200%	Swiss-Prot	High
`Q9SVG0`	Arabidopsis thaliana	sp\|Q9SVG0\|AVT3C_ARATH Amino acid transporter AVT3C	62.200%	Swiss-Prot	High
`Q9FKY3`	Arabidopsis thaliana	sp\|Q9FKY3\|AVT3A_ARATH Amino acid transporter AVT3A	60.200%	Swiss-Prot	High
`Q9SF09`	Arabidopsis thaliana	sp\|Q9SF09\|ANT1_ARATH Amino acid transporter ANT1	33.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card