TkA05G450320 | RubberDandelionOmics

Gene overview

TkA05G450320

Reference: TK1151 Chr: Chr05 Coordinates: 112581654-112585699 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1857 bp · TkA05G450320|TK1151|cDNA

GGGACCGGAGGACTGGCGGTGGTCAATGCCAACGAATGTATACCGCAGCCGCGTCGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTACACGACTTCTAATCGGATGACTTGTAAGGATTTGTATTTGTGAATCATTTCCAACGACTATTCCCAGTCGGTCTAGTCGCCATTTCATCACTTCCTTGACCAGTCGTTGCGTAATTCTGTTTGATTCGATCGAAATTTGTGCGACCTTCGAGAAAGTCAGGAGGGGATT...

CDS

Download CDS FASTA

1182 bp · TkA05G450320|TK1151|CDS

ATGGTGAAGGAGACAGAGTACTACGACGTCCTCGGGGTTAATCCCACGGCCACCGAATCTGAGATTAAGAAAGCTTATTACATCAAGGCACGACAAGTTCATCCAGATAAGAATCCAAATGATCCTCTTGCAGCTCAAAATTTTCAGGTTTTAGGAGAAGCTTATCAAGTACTAAGTAATCCAGAACAAAGACAGGCTTATGATGCTTATGGAAAATCAGGAATCTCAACTGAAGCAATCATTGATCCTGCTGCCATATT...

Protein

Download Protein FASTA

393 aa · TkA05G450320|TK1151|PROTEIN

MVKETEYYDVLGVNPTATESEIKKAYYIKARQVHPDKNPNDPLAAQNFQVLGEAYQVLSNPEQRQAYDAYGKSGISTEAIIDPAAIFAMLFGSELFEEYIGQLAMASMASLDIFTEGEQFDAKKLQEKMRIVQKEREEKLIQTLKDRLTPYVQGNKDEFVRNAEAEVLRLSNAAYGVDMLNTIGYIYARQAAKELGKKAIYLGVPFIAEWFRNKGHFIKSQVTAATGALALIQLQEDMKKQLSAEGKYSEEELEEYMQSH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G450320`
TK1151 ID	TkA05G450320
OH-1004 ID	LXL04_022200
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G450320

Location Chr05:112581654-112585699 (+)

Description Similar to ATJ10: Chaperone protein dnaJ 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76700`	Plays a continuous role in plant development probably in the structural organization of compartments.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022200 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0006626 protein targeting to mitochondrion Biological Process

GO:0016558 protein import into peroxisome matrix Biological Process

GO:0045040 protein insertion into mitochondrial outer membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005933 cellular bud Cellular Component

GO:0071944 cell periphery Cellular Component

KEGG gene cross-reference

ath:AT1G76700

sce:YER048C

sce:YIR004W

spo:2540676

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.451

Rank 1 · TkA05G450320 · TK1151

Nucleus0.246

Rank 2 · TkA05G450320 · TK1151

Mitochondrion0.220

Rank 3 · TkA05G450320 · TK1151

Endoplasmic reticulum0.177

Rank 4 · TkA05G450320 · TK1151

Cell membrane0.098

Rank 5 · TkA05G450320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226DnaJ6-68 aa

PF13446RPT8-32 aa

PF13446RPT121-142 aa

PF14308DnaJ-X133-324 aa

PF25974GVIN1133-160 aa

PF07352Phage_Mu_Gam134-171 aa

PF25974GVIN1209-265 aa

PF07352Phage_Mu_Gam236-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G450320	`PF00226`	DnaJ	6	68	1.1e-25	90.2
TkA05G450320	`PF13446`	RPT	8	32	0.069	13.7
TkA05G450320	`PF13446`	RPT	121	142	0.069	13.7
TkA05G450320	`PF14308`	DnaJ-X	133	324	1e-56	192.4
TkA05G450320	`PF25974`	GVIN1	133	160	0.14	12.9
TkA05G450320	`PF07352`	Phage_Mu_Gam	134	171	0.073	13.7
TkA05G450320	`PF25974`	GVIN1	209	265	0.14	12.9
TkA05G450320	`PF07352`	Phage_Mu_Gam	236	262	0.073	13.7
TkA05G450320	`PF18494`	Pullulanase_Ins	272	327	0.29	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYX8`	Arabidopsis thaliana	sp\|Q8GYX8\|DNJ10_ARATH Chaperone protein dnaJ 10	74.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card