TkA05G444700 | RubberDandelionOmics

Gene overview

TkA05G444700

Reference: TK1151 Chr: Chr05 Coordinates: 111224829-111229140 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3686 bp · TkA05G444700|TK1151|cDNA

AGTAGTAATGCGTCATCCGGATTAGGTTGTCCATTGAGCATTTCTGATGCATAAAGATCGGGATTAGGTTTTAGTTCATCCCCAAAAGCAAAAACTATTCCTCAGTCGGAAACAAGATTATGTAAACTCAAAATTCTCTCTATGTTATTTATCATATTTAACCATTGCGCAAATTATTACGTTTTCCTCTTGAATCTGTCGTGGGGCTCCTCTTAATCGATTCGAATTTGCTTTTTTCTGGGCCAAGAGAATTATAGGGT...

CDS

Download CDS FASTA

2457 bp · TkA05G444700|TK1151|CDS

ATGACTGATGTTCGACCACAACTGCTACAGAAGCCCGAAAGCACCACCGATGCCTGTTCAGATTTTGAAAACGACGGGTCTGATTTTGAGAGAGGATTAGAAGAGTTTATGAGAGGGCATCTGGACGATTGTCTGTCATTCGCATCATGCAGCTCACCTCACGGGGACGACGACGAGAGTGAAACCGGCGATCAGCTTGTGAGAAGAAGAAGAAGGTCAGATCTAGAAGGCGATGATCTGGCCGAAACTTCTGCAGCTAG...

Protein

Download Protein FASTA

818 aa · TkA05G444700|TK1151|PROTEIN

MTDVRPQLLQKPESTTDACSDFENDGSDFERGLEEFMRGHLDDCLSFASCSSPHGDDDESETGDQLVRRRRRSDLEGDDLAETSAARRRQSRILSRWAARQAQEMITNIERRNRESELMALAGLHTVSMLDSSFLRESESHSQSPTSRTQGNNHNHNIERPSTQASSILQMWRELEDEHVINRARERVRERLRQHGSVDSNTITNMSEGQATSEHQGSLEDITESETDYRAWSNDQMEAQNDINSSREQSPDLPDGERER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G444700`
TK1151 ID	TkA05G444700
OH-1004 ID	LXL04_022099
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 75.184 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G444700`
Location	Chr05:111224829-111229140 (-)
Description	Similar to neur: Protein neuralized
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022099` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0007219 Notch signaling pathway Biological Process GO:0008104 intracellular protein localization Biological Process GO:0008356 asymmetric cell division Biological Process GO:0008593 regulation of Notch signaling pathway Biological Process GO:0016567 protein ubiquitination Biological Process GO:0030718 germ-line stem cell population maintenance Biological Process GO:0045747 positive regulation of Notch signaling pathway Biological Process GO:0045807 positive regulation of endocytosis Biological Process GO:0070086 ubiquitin-dependent endocytosis Biological Process GO:1904215 regulation of protein import into chloroplast stroma Biological Process GO:0005634 nucleus Cellular Component
KEGG gene cross-reference	ath:AT1G59560 dme:Dmel_CG11988 hsa:54492 mmu:240055 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.606

Rank 1 · TkA05G444700 · TK1151

Nucleus0.464

Rank 2 · TkA05G444700 · TK1151

Cell membrane0.075

Rank 3 · TkA05G444700 · TK1151

Mitochondrion0.060

Rank 4 · TkA05G444700 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA05G444700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13920zf-C3HC4_3763-810 aa

PF13639zf-RING_2765-805 aa

PF03854zf-P11766-808 aa

PF13923zf-C3HC4_2766-804 aa

PF14447Prok-RING_4766-807 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G444700	`PF13920`	zf-C3HC4_3	763	810	1.5e-11	44.6
TkA05G444700	`PF13639`	zf-RING_2	765	805	0.0059	17.6
TkA05G444700	`PF03854`	zf-P11	766	808	0.14	12.5
TkA05G444700	`PF13923`	zf-C3HC4_2	766	804	1.1	9.8
TkA05G444700	`PF14447`	Prok-RING_4	766	807	4.0	8.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card