TkA05G444390 | RubberDandelionOmics

Gene overview

TkA05G444390

Reference: TK1151 Chr: Chr05 Coordinates: 111123254-111126427 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1612 bp · TkA05G444390|TK1151|cDNA

TTAAACCTCTCCCCTTCCATCTCTTCCCTTCGTTTTCTTTTCTCCCTCCAAAATTTCTCCCTCACTTTGCTTCCATGGCGGTGGCAGACCTAAGCCCTGCTTACACAAGTACTGATTTCACCAATTCGTGCTTCTCTTATGTTTCATCATCGACTCGTCTCTCCTCCCACCGCCGCCTAAGTTATCGCCATCTCCCTCGAACTTCGACCACCGCTATCCGCTGCTCTGTAACCTCCGACAAAATTCAAGCACCGGCTGGT...

CDS

Download CDS FASTA

1320 bp · TkA05G444390|TK1151|CDS

ATGGCGGTGGCAGACCTAAGCCCTGCTTACACAAGTACTGATTTCACCAATTCGTGCTTCTCTTATGTTTCATCATCGACTCGTCTCTCCTCCCACCGCCGCCTAAGTTATCGCCATCTCCCTCGAACTTCGACCACCGCTATCCGCTGCTCTGTAACCTCCGACAAAATTCAAGCACCGGCTGGTATTGATATCAGTGATCCGAAACAGAAGACTGAATGTTTTGGTGTATTCTGCCTCACTTATGATCTGAAGGCCGA...

Protein

Download Protein FASTA

439 aa · TkA05G444390|TK1151|PROTEIN

MAVADLSPAYTSTDFTNSCFSYVSSSTRLSSHRRLSYRHLPRTSTTAIRCSVTSDKIQAPAGIDISDPKQKTECFGVFCLTYDLKADDETQSWKKMINVAVSGAAGMISNHLLFKLASGEVFGPDQPIALKLLGSERSFGALEGVAMELEDSLFPLLREVSIGIDPYEVFEDAEWALLIGAKPRGPGMERADLLDINGQIFAEQGKALNKVASRNVKVMVVGNPCNTNALICMKNAPNIPAKNFHALTRLDENRAKCQLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G444390`
TK1151 ID	TkA05G444390
OH-1004 ID	LXL04_022094
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G444390

Location Chr05:111123254-111126427 (-)

Description Similar to Malate dehydrogenase [NADP], chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58330`	The chloroplastic, NADP-dependent form is essential for the photosynthesis C4 cycle, which allows plants to circumvent the problem of photorespiration.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022094 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006107 oxaloacetate metabolic process Biological Process

GO:0006108 malate metabolic process Biological Process

GO:0019674 NAD+ metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0030060 L-malate dehydrogenase (NAD+) activity Molecular Function

GO:0046554 L-malate dehydrogenase (NADP+) activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.968

Rank 1 · TkA05G444390 · TK1151

Mitochondrion0.046

Rank 2 · TkA05G444390 · TK1151

Cytoplasm0.021

Rank 3 · TkA05G444390 · TK1151

Nucleus0.018

Rank 4 · TkA05G444390 · TK1151

Cell membrane0.014

Rank 5 · TkA05G444390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00056Ldh_1_N98-245 aa

PF02866Ldh_1_C211-224 aa

PF02866Ldh_1_C248-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G444390	`PF00056`	Ldh_1_N	98	245	1.2e-35	123.3
TkA05G444390	`PF02866`	Ldh_1_C	211	224	1.9e-48	165.4
TkA05G444390	`PF02866`	Ldh_1_C	248	418	1.9e-48	165.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1E2`	Arabidopsis thaliana	sp\|Q8H1E2\|MDHNP_ARATH Malate dehydrogenase [NADP], chloroplastic	78.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card