TkA03G450110 | RubberDandelionOmics

Gene overview

TkA03G450110

Reference: TK1151 Chr: Chr03 Coordinates: 112327241-112329273 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1016 bp · TkA03G450110|TK1151|cDNA

CTGCCAAGAATCAAGATGGTGCCACTACGTACCAGAGTCTTTAATTTTCCCGTCTTCCCTTCTCTGGGGACTTTCATCAAACACTTTGAGCGCACTCCAAATCTCAAACCAACGGTCATAACCAGAAGAGGCGCATCAACAAAATCCTCAATCGTCAATGCCTCCCACTTCGACACCCTAAATCCTCTACAGAAACAACAAGTCCAGCTCTACGTCGATGCTCTTCTCGTTTGGAACCAGAAGATAAACCTTACTGCAGT...

CDS

Download CDS FASTA

855 bp · TkA03G450110|TK1151|CDS

ATGGTGCCACTACGTACCAGAGTCTTTAATTTTCCCGTCTTCCCTTCTCTGGGGACTTTCATCAAACACTTTGAGCGCACTCCAAATCTCAAACCAACGGTCATAACCAGAAGAGGCGCATCAACAAAATCCTCAATCGTCAATGCCTCCCACTTCGACACCCTAAATCCTCTACAGAAACAACAAGTCCAGCTCTACGTCGATGCTCTTCTCGTTTGGAACCAGAAGATAAACCTTACTGCAGTTAGAGAGGCAAGTGA...

Protein

Download Protein FASTA

284 aa · TkA03G450110|TK1151|PROTEIN

MVPLRTRVFNFPVFPSLGTFIKHFERTPNLKPTVITRRGASTKSSIVNASHFDTLNPLQKQQVQLYVDALLVWNQKINLTAVREASDVMDRHIEDSLAIIPPIQSSYISHCEPSIENLKLVDVGSGAGLPGLILAIACPGWQVTLLESLNKRCIFLEYAVGLIGLSNVKVVRGRAEDVGQNQEFREVFDVTVARAVAEMRILAEYCLPLVRVGGLFVAAKGHAPEEEVERAKRAISLMGASLLKTCYVDSHSPHGQRTAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G450110`
TK1151 ID	TkA03G450110
OH-1004 ID	LXL04_009591
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G450110`
Location	Chr03:112327241-112329273 (+)
Description	Similar to rsmG: Ribosomal RNA small subunit methyltransferase G (Alkaliphilus oremlandii (strain OhILAs)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009591` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005829 cytosol Cellular Component GO:0070043 rRNA (guanine-N7-)-methyltransferase activity Molecular Function
KEGG gene cross-reference	amt:Amet_4795 aoe:Clos_2870 lac:LBA1829 sam:MW2628 sar:SAR2796 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.589

Rank 1 · TkA03G450110 · TK1151

Mitochondrion0.465

Rank 2 · TkA03G450110 · TK1151

Cytoplasm0.060

Rank 3 · TkA03G450110 · TK1151

Nucleus0.044

Rank 4 · TkA03G450110 · TK1151

Peroxisome0.013

Rank 5 · TkA03G450110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02527GidB59-245 aa

PF30636Methyltransf_37109-218 aa

PF10294Methyltransf_16112-161 aa

PF05175MTS117-148 aa

PF13847Methyltransf_31117-197 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G450110	`PF02527`	GidB	59	245	2e-50	171.4
TkA03G450110	`PF30636`	Methyltransf_37	109	218	0.047	14.4
TkA03G450110	`PF10294`	Methyltransf_16	112	161	0.019	15.4
TkA03G450110	`PF05175`	MTS	117	148	0.29	11.4
TkA03G450110	`PF13847`	Methyltransf_31	117	197	0.32	11.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card