TkA03G399090 | RubberDandelionOmics

Gene overview

TkA03G399090

Reference: TK1151 Chr: Chr03 Coordinates: 99181205-99194351 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6042 bp · TkA03G399090|TK1151|cDNA

ACAACATCCAAGAACACCAACTTTTATCTAATTTCTTTTTTATTTTTTTTTTTCAAGTTTTGTTTTTTTTTAAAATAACATTACAATAATTAAAAATTACAACAATAAAAATAGTCGTGTTTCTTTAACGATTAAAAAAATATTTATGCTAAAGTTGGATGTCGCAGATTTTGTAGACTTTCGTTGGATACTTGGATTTGGATGTTGCTATTATAGGTTGCTGTTATAGGCCTCTTAATAGTATTTCGACATTATAGTGT...

CDS

Download CDS FASTA

1506 bp · TkA03G399090|TK1151|CDS

ATGGCTACCGAAAATGGCGACAATTTCAGGTACTTGGTTGTGCAGCCTGAAAATGGCGGACTTACGGACCTTTTAAGATACGGAATTTGGGGCAACAAAGCCAGCGGCGCAAAGTTCTTCGAGAGTTCCGACGAAGGTACCCTCCACGAGGAACTGCCGGTGGGTGGCGACAGAGAAACGCCGGCCCATAGATGGGTGATCATAGTATCCATTGTAATGAGGAAGTTGATAAAGTTTTTTGGCAAGCCAATGGAATGGAC...

Protein

Download Protein FASTA

501 aa · TkA03G399090|TK1151|PROTEIN

MATENGDNFRYLVVQPENGGLTDLLRYGIWGNKASGAKFFESSDEGTLHEELPVGGDRETPAHRWVIIVSIVMRKLIKFFGKPMEWTGYVVDFILNLLSFNGGLLSLLFNFLQGKMVIPVRGSATFISTIGHIDGRIDLQHPGDAFANIELDARNKSLMDLCMMASKLAYENAVVIKNVVNLNWKMHFIDFYNCWNDYQKERSTQVFIFSDKPTDANLIVISFRGTEPFDADDWITDFDYSWYEIPKLGKVHMGFLEAMG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G399090`
TK1151 ID	TkA03G399090
OH-1004 ID	LXL04_009116
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G399090

Location Chr03:99181205-99194351 (+)

Description Similar to OBL1: Triacylglycerol lipase OBL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14360`	Acid lipase that can hydrolyze a range of triacylglycerols without a clear preference for acyl-chains.	Characterization of the enzymatic activity and physiological function of the lipid droplet-associated triacylglycerol lipase AtOBL1.2018 · DOI: 10.1111/nph.14902

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009116 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016042 lipid catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0016020 membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004806 triacylglycerol lipase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0047372 monoacylglycerol lipase activity Molecular Function

GO:0120516 diacylglycerol lipase activity Molecular Function

KEGG gene cross-reference

ath:AT3G14360

nta:107788962

rcu:8284735

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.318

Rank 1 · TkA03G399090 · TK1151

Cytoplasm0.214

Rank 2 · TkA03G399090 · TK1151

Golgi apparatus0.153

Rank 3 · TkA03G399090 · TK1151

Mitochondrion0.134

Rank 4 · TkA03G399090 · TK1151

Lysosome / Vacuole0.133

Rank 5 · TkA03G399090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26363Phospholipase-like203-239 aa

PF11187Mbeg1-like214-228 aa

PF01764Lipase_3220-394 aa

PF11187Mbeg1-like294-356 aa

PF12695Abhydrolase_5294-329 aa

PF12146Hydrolase_4302-349 aa

PF26363Phospholipase-like303-328 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G399090	`PF26363`	Phospholipase-like	203	239	9.5e-06	25.7
TkA03G399090	`PF11187`	Mbeg1-like	214	228	0.021	14.9
TkA03G399090	`PF01764`	Lipase_3	220	394	1.5e-35	122.8
TkA03G399090	`PF11187`	Mbeg1-like	294	356	0.021	14.9
TkA03G399090	`PF12695`	Abhydrolase_5	294	329	0.054	14.0
TkA03G399090	`PF12146`	Hydrolase_4	302	349	0.031	14.3
TkA03G399090	`PF26363`	Phospholipase-like	303	328	9.5e-06	25.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JFU8`	Arabidopsis thaliana	sp\|F4JFU8\|OBL1_ARATH Triacylglycerol lipase OBL1	58.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card