TkA03G349430 | RubberDandelionOmics

Gene overview

TkA03G349430

Reference: TK1151 Chr: Chr03 Coordinates: 85988245-85990646 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1719 bp · TkA03G349430|TK1151|cDNA

CAAGAATCGAGTACGGCAATATATCAATGAAAAAGCAAACTATCAGCCGATCATGACCGTTTACACAAAGTCATCAAATATACTACGGCTATGATAGATTAGTCCTCACCACAACTTCGTGAGTACCCGTAGCACACAATCTTTACTCAGTCTTCGCCAACGTCCCCACCAGGCCACCAACTACTTAAACCCTTGCCGTCGTACACATCTCCTTTATTTCTCTCTGTTGAATATCGGGACTCGGGAGTCGGGAGCTAGTT...

CDS

Download CDS FASTA

1203 bp · TkA03G349430|TK1151|CDS

ATGGCAGCTACATCATCAAGTTCCTTCTCTATCGGATCAATACCCCATGGTTCCAAAACCTGCTCAATTGGACAATCAAACAATCATGGAATGAAATTCAATTCCCGAAACCATCTTAACAATTTCACCGGCCTCAAGGCAGTCACATCTATAAACCCCAACTCCAACTCCAAATCATCCATCTTCGGCAACAATATCACTGTTAGGCCAGCCACTATAACCAAAACACGACGAAACACCATTAAAGTCACCGCATCATT...

Protein

Download Protein FASTA

400 aa · TkA03G349430|TK1151|PROTEIN

MAATSSSSFSIGSIPHGSKTCSIGQSNNHGMKFNSRNHLNNFTGLKAVTSINPNSNSKSSIFGNNITVRPATITKTRRNTIKVTASFKVAILGAAGGIGQPLSLLVKMSPLVSDLHLYDIANVKGVAADLSHCNTPSKVQHFTGATELPNCLQDIDIVVIPAGVPRKPGMTRDDLFNINASIVKTLVEAVADNCPNAFIHVISNPVNSTVPIAAEILKQKGVYNPKKLFGVTTLDVVRANTFVSQKKNLKLIDVDVPVIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G349430`
TK1151 ID	TkA03G349430
OH-1004 ID	LXL04_008650
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 91.954 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G349430

Location Chr03:85988245-85990646 (-)

Description Similar to At3g47520: Malate dehydrogenase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g47520`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	No verified direct reference in this release
`At2g22780`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent.2010 · DOI: 10.1007/s11103-009-9554-2
`At5g09660`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent.2010 · DOI: 10.1007/s11103-009-9554-2

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0632700`	Malate dehydrogenase, glyoxysomal.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008650 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006108 malate metabolic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

KEGG gene cross-reference

ath:AT3G47520

csv:101219252

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.979

Rank 1 · TkA03G349430 · TK1151

Mitochondrion0.036

Rank 2 · TkA03G349430 · TK1151

Cytoplasm0.015

Rank 3 · TkA03G349430 · TK1151

Peroxisome0.010

Rank 4 · TkA03G349430 · TK1151

Nucleus0.010

Rank 5 · TkA03G349430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22299BRISC_FAM175B_helical38-52 aa

PF00056Ldh_1_N88-230 aa

PF01118Semialdhyde_dh88-162 aa

PF010733Beta_HSD91-203 aa

PF02866Ldh_1_C232-397 aa

PF01118Semialdhyde_dh256-278 aa

PF22299BRISC_FAM175B_helical271-293 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G349430	`PF22299`	BRISC_FAM175B_helical	38	52	0.29	11.6
TkA03G349430	`PF00056`	Ldh_1_N	88	230	9.9e-49	165.7
TkA03G349430	`PF01118`	Semialdhyde_dh	88	162	0.023	15.8
TkA03G349430	`PF01073`	3Beta_HSD	91	203	0.0005	19.9
TkA03G349430	`PF02866`	Ldh_1_C	232	397	4.8e-43	147.9
TkA03G349430	`PF01118`	Semialdhyde_dh	256	278	0.023	15.8
TkA03G349430	`PF22299`	BRISC_FAM175B_helical	271	293	0.29	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SN86`	Arabidopsis thaliana	sp\|Q9SN86\|MDHP_ARATH Malate dehydrogenase, chloroplastic	74.800%	Swiss-Prot	High
`O82399`	Arabidopsis thaliana	sp\|O82399\|MDHX1_ARATH Malate dehydrogenase 1, peroxisomal	64.600%	Swiss-Prot	High
`Q9ZP05`	Arabidopsis thaliana	sp\|Q9ZP05\|MDHX2_ARATH Malate dehydrogenase 2, peroxisomal	65.600%	Swiss-Prot	High
`Q42972`	Oryza sativa subsp. japonica	sp\|Q42972\|MDHG_ORYSJ Malate dehydrogenase, glyoxysomal	66.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card