TkA03G312390 | RubberDandelionOmics

Gene overview

TkA03G312390

Reference: TK1151 Chr: Chr03 Coordinates: 76763756-76764544 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

789 bp · TkA03G312390|TK1151|cDNA

ATGAGTGGCACAAATAAAGAGATAATAATGCAGACTTCTTCATTTCCATACAACAACCAGCACTTGATTCAAGCACCCTCCTCGGAAATAAAGGATCATCGGTCTGACCCAGATCGGTTTGATGGGTCTGGAGCTTCAGTTACACCCATATCAGTCGGATCTTGGCTCTTAAAGTCACCACCGCCGCGGTACCGAGAGTGCTTGAAAAACTATGCGGCGAACAGCGGTGGGAGTATCACTGACGGATGCGGCGAGTTCAT...

CDS

Download CDS FASTA

789 bp · TkA03G312390|TK1151|CDS

ATGAGTGGCACAAATAAAGAGATAATAATGCAGACTTCTTCATTTCCATACAACAACCAGCACTTGATTCAAGCACCCTCCTCGGAAATAAAGGATCATCGGTCTGACCCAGATCGGTTTGATGGGTCTGGAGCTTCAGTTACACCCATATCAGTCGGATCTTGGCTCTTAAAGTCACCACCGCCGCGGTACCGAGAGTGCTTGAAAAACTATGCGGCGAACAGCGGTGGGAGTATCACTGACGGATGCGGCGAGTTCAT...

Protein

Download Protein FASTA

262 aa · TkA03G312390|TK1151|PROTEIN

MSGTNKEIIMQTSSFPYNNQHLIQAPSSEIKDHRSDPDRFDGSGASVTPISVGSWLLKSPPPRYRECLKNYAANSGGSITDGCGEFMPSGDEGTLEALKCAACNCHRNFHRKETTTTTVVTAGPLLQLPPPLPSSAPLVNHHQRTATTNWVSSINAPPVRMAVGGICAATESSSEDLYFTAAAVPYGVAKKRFRSKFTQDQKEKMLEFAEKVGWRIPREDDPEAQRFCAEVGVKRQVLKVWMHNNKAISGKKHVADSDDT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G312390`
TK1151 ID	TkA03G312390
OH-1004 ID	LXL04_008913
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.200
Protein coverage (%)	TK1151 96.565 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G312390

Location Chr03:76763756-76764544 (+)

Description Similar to ZHD6: Zinc-finger homeodomain protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14440`	Putative transcription factor.	No verified direct reference in this release
`At2g18350`	Putative transcription factor.	No verified direct reference in this release
`At4g24660`	Essential protein.	No verified direct reference in this release
`At5g65410`	Putative transcription factor.	No verified direct reference in this release
`At2g02540`	Putative transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008913 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048574 long-day photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G14440

ath:AT1G75240

ath:AT2G02540

ath:AT2G18350

ath:AT4G24660

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.970

Rank 1 · TkA03G312390 · TK1151

Cytoplasm0.091

Rank 2 · TkA03G312390 · TK1151

Cell membrane0.026

Rank 3 · TkA03G312390 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA03G312390 · TK1151

Plastid0.010

Rank 5 · TkA03G312390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04770ZF-HD_dimer63-114 aa

PF19818DUF6301203-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G312390	`PF04770`	ZF-HD_dimer	63	114	3.5e-29	101.6
TkA03G312390	`PF19818`	DUF6301	203	246	0.19	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9S0`	Arabidopsis thaliana	sp\|Q9M9S0\|ZHD4_ARATH Zinc-finger homeodomain protein 4	47.800%	Swiss-Prot	Medium
`Q9ZPW7`	Arabidopsis thaliana	sp\|Q9ZPW7\|ZHD6_ARATH Zinc-finger homeodomain protein 6	50.500%	Swiss-Prot	High
`Q9SB61`	Arabidopsis thaliana	sp\|Q9SB61\|ZHD2_ARATH Zinc-finger homeodomain protein 2	50.300%	Swiss-Prot	High
`Q9FKP8`	Arabidopsis thaliana	sp\|Q9FKP8\|ZHD1_ARATH Zinc-finger homeodomain protein 1	50.300%	Swiss-Prot	High
`O64722`	Arabidopsis thaliana	sp\|O64722\|ZHD3_ARATH Zinc-finger homeodomain protein 3	42.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card