TkA03G153730 | RubberDandelionOmics

Gene overview

TkA03G153730

Reference: TK1151 Chr: Chr03 Coordinates: 39007939-39009558 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1320 bp · TkA03G153730|TK1151|cDNA

ATGGCCGCTACGAATTTTCAATCTGATGATAGCGGCGGCGGCGGCGTTATAAAAAACCCTAGGTCCCCGGGACATTCACAGCCGGTTTCATCTCCGTGGAGTACGATTGTACAGGGTCCGCCGGTGATGGTATCCGATGCTGTTTCCTCGGCGCCGGTTTCTGTTACCCCAGCACCGACGTTTTCATCTTCCGTTGTGGAGAAAATAGGTAACTTTACCTCGGATTGGTCTCCGCCTTCAATGGTGCCGGATGTCGTAAG...

CDS

Download CDS FASTA

1320 bp · TkA03G153730|TK1151|CDS

ATGGCCGCTACGAATTTTCAATCTGATGATAGCGGCGGCGGCGGCGTTATAAAAAACCCTAGGTCCCCGGGACATTCACAGCCGGTTTCATCTCCGTGGAGTACGATTGTACAGGGTCCGCCGGTGATGGTATCCGATGCTGTTTCCTCGGCGCCGGTTTCTGTTACCCCAGCACCGACGTTTTCATCTTCCGTTGTGGAGAAAATAGGTAACTTTACCTCGGATTGGTCTCCGCCTTCAATGGTGCCGGATGTCGTAAG...

Protein

Download Protein FASTA

439 aa · TkA03G153730|TK1151|PROTEIN

MAATNFQSDDSGGGGVIKNPRSPGHSQPVSSPWSTIVQGPPVMVSDAVSSAPVSVTPAPTFSSSVVEKIGNFTSDWSPPSMVPDVVSSPDDSGTDGQGSDSSGVSGSNTSKKPAWNKPNGAVEVVSPVMGAVSWPALGESTKASPKSSSSESLNALGDGPLLPSLQVNFQLSIVTGNSSPLSHKQTSANTIHVAPSRQRSMKRGGGTSNSNPSPNGDKTQVESPRGNFGPQSHNSNNTNDHQQHQRGSYRRSNSGQHHNY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G153730`
TK1151 ID	TkA03G153730
OH-1004 ID	LXL04_007313
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.300
Protein coverage (%)	TK1151 95.444 / OH-1004 83.626 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G153730

Location Chr03:39007939-39009558 (-)

Description Similar to LARP1C: La-related protein 1C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35890`	Promotes leaf senescence mediated by abscisic acid (ABA), salicylic acid (SA) and jasmonic acid (MeJA), probably though the induction of expression of senescence-associated genes (SAGs) and defense-related genes.	Overexpression of a LAM domain containing RNA-binding protein LARP1c induces precocious leaf senescence in Arabidopsis.2012 · DOI: 10.1007/s10059-012-0111-5
`At5g66100`	Promotes leaf senescence.	No verified direct reference in this release
`At5g21160`	Required for acclimation and survival during thermal stress.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007313 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006402 mRNA catabolic process Biological Process

GO:0006413 translational initiation Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009749 response to glucose Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010286 heat acclimation Biological Process

GO:0010608 post-transcriptional regulation of gene expression Biological Process

GO:0016239 positive regulation of macroautophagy Biological Process

KEGG gene cross-reference

ath:AT4G35890

ath:AT5G21160

ath:AT5G66100

hsa:23367

hsa:55132

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.730

Rank 1 · TkA03G153730 · TK1151

Nucleus0.254

Rank 2 · TkA03G153730 · TK1151

Cell membrane0.069

Rank 3 · TkA03G153730 · TK1151

Golgi apparatus0.061

Rank 4 · TkA03G153730 · TK1151

Lysosome / Vacuole0.043

Rank 5 · TkA03G153730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05383La379-422 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G153730	`PF05383`	La	379	422	1.2e-18	67.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94K80`	Arabidopsis thaliana	sp\|Q94K80\|LRP1C_ARATH La-related protein 1C	37.300%	Swiss-Prot	Medium
`Q8RWR2`	Arabidopsis thaliana	sp\|Q8RWR2\|LRP1B_ARATH La-related protein 1B	36.800%	Swiss-Prot	Low
`Q940X9`	Arabidopsis thaliana	sp\|Q940X9\|LRP1A_ARATH La-related protein 1A	50.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card