TkA02G325580 | RubberDandelionOmics

Gene overview

TkA02G325580

Reference: TK1151 Chr: Chr02 Coordinates: 82603012-82616870 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2999 bp · TkA02G325580|TK1151|cDNA

AAGGAGTAGCGTGGTAGCCCAAAATATTAGTGTTCGTGATGAATGGGAGGCAATATGAAATTGGAAAGATTTCAAAGAACGCATCCGTCGCCAAATCGCCAATGATGCCACGATCATCGGCTGAAATCTATGGAGTAAAATCAGTAACCGCCAGGCGTCAACTACCTATCTTCTCGCTGATCCTTCTTATCTCGGACTTGTGAAGCGCAGTCGCACAACTCGCAATTCTCATTCGCACAACTCCCAAATCGTAATATCGA...

CDS

Download CDS FASTA

2106 bp · TkA02G325580|TK1151|CDS

ATGAGACCTTGCATAACGATCGGCGTCAGCTTTCTATTTGTCTCTTATCATGTCGCCAATGGCAGCGTCCAACTCCTTTCCAAATCGAAGCTTCAAAAATGCGAAAAGGTTTCAAATGATGCTCCTCTTAACTGCACCAAAAAAGTAATCGTCAATATGGCTGTTCCTAGTGAATCAAGCGGCAGAGAAGCATCGCTTGTAGCTGAAATAGTGGAGGTCGAGGAAAATGCGACTGATAATAACATGAGAACGGTTCGAGA...

Protein

Download Protein FASTA

701 aa · TkA02G325580|TK1151|PROTEIN

MRPCITIGVSFLFVSYHVANGSVQLLSKSKLQKCEKVSNDAPLNCTKKVIVNMAVPSESSGREASLVAEIVEVEENATDNNMRTVRDPPVITVNKSAAYAQYHLTYIRDVPYKPEELYFKTRKCDRNAGPNIVHDCVALRDEHGHIIERTKPFCCSCGGQRRVPSSCGNFFDKMVKGKVNTAHCLRFPGEWFHVFGIGQHSVGFTIRVEVKTGSKISEVIISPQNRTAISHDKFLRVNLIGDYVGYNDIPSFENFFLVTP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G325580`
TK1151 ID	TkA02G325580
OH-1004 ID	LXL04_015497
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	94.500
Protein coverage (%)	TK1151 96.719 / OH-1004 96.724 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G325580

Location Chr02:82603012-82616870 (-)

Description Similar to HAP2: Protein HAPLESS 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g11720`	Required for male fertility.	Arabidopsis HAP2 (GCS1) is a sperm-specific gene required for pollen tube guidance and fertilization.2006 · DOI: 10.1242/dev.02683 HAP2(GCS1)-dependent gamete fusion requires a positively charged carboxy-terminal domain.2010 · DOI: 10.1371/journal.pgen.1000882 The functional domain of GCS1-based gamete fusion resides in the amino terminus in plant and parasite species.2010 · DOI: 10.1371/journal.pone.0015957 Egg cell-secreted EC1 triggers sperm cell activation during double fertilization.2012 · DOI: 10.1126/science.1223944 Arabidopsis HAP2/GCS1 is a gamete fusion protein homologous to somatic and viral fusogens.2017 · DOI: 10.1083/jcb.201610093

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0269500`	Required for male fertility.	No verified direct reference in this release
`Os09g0525700`	Required for male fertility.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015497 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007338 single fertilization Biological Process

GO:0007342 fusion of sperm to egg plasma membrane involved in single fertilization Biological Process

GO:0009566 fertilization Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0045026 plasma membrane fusion Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0051205 protein insertion into membrane Biological Process

GO:0061936 fusion of sperm to egg plasma membrane involved in double fertilization forming a zygote and endosperm Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT4G11720

dosa:Os05g0269500

dosa:Os09g0525700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.556

Rank 1 · TkA02G325580 · TK1151

Cytoplasm0.204

Rank 2 · TkA02G325580 · TK1151

Extracellular0.167

Rank 3 · TkA02G325580 · TK1151

Endoplasmic reticulum0.121

Rank 4 · TkA02G325580 · TK1151

Golgi apparatus0.119

Rank 5 · TkA02G325580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10699HAP2-GCS143-555 aa

PF02535Zip613-684 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G325580	`PF10699`	HAP2-GCS1	43	555	1e-142	477.1
TkA02G325580	`PF02535`	Zip	613	684	0.48	10.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JP36`	Arabidopsis thaliana	sp\|F4JP36\|HAP2_ARATH Protein HAPLESS 2	65.700%	Swiss-Prot	High
`Q5W6B9`	Oryza sativa subsp. japonica	sp\|Q5W6B9\|HAP2A_ORYSJ Protein HAPLESS 2-A	55.700%	Swiss-Prot	High
`B9G4M9`	Oryza sativa subsp. japonica	sp\|B9G4M9\|HAP2B_ORYSJ Protein HAPLESS 2-B	55.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card