TkA01G594290 | RubberDandelionOmics

Gene overview

TkA01G594290

Reference: TK1151 Chr: Chr01 Coordinates: 149652439-149655369 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2088 bp · TkA01G594290|TK1151|cDNA

TTACTGTTGACTCATAAGTCATAGCCTAATGTCCTGTTGTATAATTCACTATAAATACACCACCATTTTTTGCAACAAAATCACACTTGTAAACACTACAAACACAATGGACTCCGTTATCAGTTATTTTTTCAATGCCATTTTGGTTGCTGTCATCTTTACACTTGTTCCCATAACCAATGCTAATGAAGAAACTCATTACCATGAGTTTAAGGTTCAAGAGCAAGCGGTCAAGAGGCTATGCAAATCCCATACGATAA...

CDS

Download CDS FASTA

1770 bp · TkA01G594290|TK1151|CDS

ATGTCCTGTTGTATAATTCACTATAAATACACCACCATTTTTTGCAACAAAATCACACTTGTAAACACTACAAACACAATGGACTCCGTTATCAGTTATTTTTTCAATGCCATTTTGGTTGCTGTCATCTTTACACTTGTTCCCATAACCAATGCTAATGAAGAAACTCATTACCATGAGTTTAAGGTTCAAGAGCAAGCGGTCAAGAGGCTATGCAAATCCCATACGATAATAACAGTCAATGGACAATTTCCTGGGCC...

Protein

Download Protein FASTA

589 aa · TkA01G594290|TK1151|PROTEIN

MSCCIIHYKYTTIFCNKITLVNTTNTMDSVISYFFNAILVAVIFTLVPITNANEETHYHEFKVQEQAVKRLCKSHTIITVNGQFPGPTLEVRNGDAVIVKVTNKARYNVTIHWHGLRQMQNPWADGPEMVTQCPIMPGNSYTYRFSIQDQEGTLWWHAHSRWLRATVYGALVIHPKLGASYPFPKPKVELPIVLGEWWNRDIISVLRQALFSGAAPNISDALTINGQPGDLIKCSQQGTIKYSVNSGDTVLLRVINAALN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G594290`
TK1151 ID	TkA01G594290
OH-1004 ID	LXL04_000679
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G594290

Location Chr01:149652439-149655369 (+)

Description Similar to LAC3: Laccase-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30210`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g05390`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g07130`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At2g40370`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0827300`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000679 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0046274 lignin catabolic process Biological Process

GO:0046688 response to copper ion Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0048046 apoplast Cellular Component

GO:0048226 Casparian strip Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0052716 hydroquinone:oxygen oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT2G30210

ath:AT2G40370

ath:AT5G05390

ath:AT5G07130

dosa:Os01g0827300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.915

Rank 1 · TkA01G594290 · TK1151

Cytoplasm0.034

Rank 2 · TkA01G594290 · TK1151

Cell membrane0.028

Rank 3 · TkA01G594290 · TK1151

Endoplasmic reticulum0.022

Rank 4 · TkA01G594290 · TK1151

Golgi apparatus0.013

Rank 5 · TkA01G594290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07732Cu-oxidase_363-176 aa

PF00394Cu-oxidase75-126 aa

PF07731Cu-oxidase_284-116 aa

PF00394Cu-oxidase190-338 aa

PF07732Cu-oxidase_3243-312 aa

PF07731Cu-oxidase_2281-312 aa

PF07731Cu-oxidase_2438-571 aa

PF00394Cu-oxidase521-562 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G594290	`PF07732`	Cu-oxidase_3	63	176	2e-47	160.8
TkA01G594290	`PF00394`	Cu-oxidase	75	126	1.4e-44	152.7
TkA01G594290	`PF07731`	Cu-oxidase_2	84	116	1.2e-43	148.8
TkA01G594290	`PF00394`	Cu-oxidase	190	338	1.4e-44	152.7
TkA01G594290	`PF07732`	Cu-oxidase_3	243	312	2e-47	160.8
TkA01G594290	`PF07731`	Cu-oxidase_2	281	312	1.2e-43	148.8
TkA01G594290	`PF07731`	Cu-oxidase_2	438	571	1.2e-43	148.8
TkA01G594290	`PF00394`	Cu-oxidase	521	562	1.4e-44	152.7
TkA01G594290	`PF07732`	Cu-oxidase_3	540	571	2e-47	160.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56YT0`	Arabidopsis thaliana	sp\|Q56YT0\|LAC3_ARATH Laccase-3	65.900%	Swiss-Prot	High
`Q9FLB5`	Arabidopsis thaliana	sp\|Q9FLB5\|LAC12_ARATH Laccase-12	68.000%	Swiss-Prot	High
`Q9LYQ2`	Arabidopsis thaliana	sp\|Q9LYQ2\|LAC13_ARATH Laccase-13	67.800%	Swiss-Prot	High
`Q9SIY8`	Arabidopsis thaliana	sp\|Q9SIY8\|LAC5_ARATH Laccase-5	62.600%	Swiss-Prot	High
`Q941X2`	Oryza sativa subsp. japonica	sp\|Q941X2\|LAC3_ORYSJ Laccase-3	63.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card