TkA01G585570 | RubberDandelionOmics

Gene overview

TkA01G585570

Reference: TK1151 Chr: Chr01 Coordinates: 147269835-147274083 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2036 bp · TkA01G585570|TK1151|cDNA

ATAAATGCCCTGGAAACCCTTTCGCTCACTTCCCCTTTACCCTGTATGTACTTGCTCTCGCCTTCGCCTCTCCAAGATCCGTAAAAGGACACAAACAAACCCTAACGCGCACACACACAGAGAAATATATTAACGAAGAAAGGGATCATAGATTCTATTCTCAATCTATTTCCTCCACGTTGCATCGTTTCTCAACGAAATCCAGGGGGTTTGATTTAATTTACAATGGCGGCTCCGACAGCGACACCGCAGCAACCTGT...

CDS

Download CDS FASTA

1449 bp · TkA01G585570|TK1151|CDS

ATGGCGGCTCCGACAGCGACACCGCAGCAACCTGTCTCCGCTCAAGTTGTTGGCAATGCTTTTGTTACACAATATTATCACATACTGCACCAGTCTCCTGGTTTAGTTCATCGATTCTATCAAGACATCAGTAAACTTGGACGCCCTGAAGAAGATGGTTCCATGAGCATAACCACTACCATGGATGCGATCAATACCAAAATACTATCTCTTAATTATGATGAGTTCAGGGCTGAGATTAAGTCTGTTGATGCACAAGA...

Protein

Download Protein FASTA

482 aa · TkA01G585570|TK1151|PROTEIN

MAAPTATPQQPVSAQVVGNAFVTQYYHILHQSPGLVHRFYQDISKLGRPEEDGSMSITTTMDAINTKILSLNYDEFRAEIKSVDAQESLDGGVNVLVTGYLTGKDNIVRNFTQSFFLAPQDKGYFVLNDIFRYMENANNNEGHSASVEDVEAPAVPEQVPKSVPVVEDQVPEKTAVMPEESEGESVFNPPENVEVAAAEVEAAVEEEPVAEVVDEVQEASQLVVESNTKIEQLPKKSYASIVADLKQSDVPFSPPPPVPR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G585570`
TK1151 ID	TkA01G585570
OH-1004 ID	LXL04_000815
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G585570

Location Chr01:147269835-147274083 (-)

Description Similar to NTF2: Nuclear transport factor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60980`	Involved in RNA-directed DNA methylation (RdDM).	AtMBD6, a methyl CpG binding domain protein, maintains gene silencing in Arabidopsis by interacting with RNA binding proteins.2017 · DOI: 10.1007/s12038-016-9658-1

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000815 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007264 small GTPase-mediated signal transduction Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0034063 stress granule assembly Biological Process

GO:0045087 innate immune response Biological Process

GO:0051028 mRNA transport Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:1990861 Ubp3-Bre5 deubiquitination complex Cellular Component

KEGG gene cross-reference

ath:AT5G60980

hsa:9908

mmu:23881

pon:100172655

spo:2541364

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.726

Rank 1 · TkA01G585570 · TK1151

Nucleus0.340

Rank 2 · TkA01G585570 · TK1151

Cell membrane0.085

Rank 3 · TkA01G585570 · TK1151

Endoplasmic reticulum0.063

Rank 4 · TkA01G585570 · TK1151

Golgi apparatus0.053

Rank 5 · TkA01G585570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02136NTF217-133 aa

PF23442DUF712561-90 aa

PF19118DUF5802146-204 aa

PF11871DUF3391171-218 aa

PF09872DUF2099174-234 aa

PF23442DUF7125192-247 aa

PF11871DUF3391220-282 aa

PF00076RRM_1308-364 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G585570	`PF02136`	NTF2	17	133	9.4e-33	113.8
TkA01G585570	`PF23442`	DUF7125	61	90	0.12	12.5
TkA01G585570	`PF19118`	DUF5802	146	204	0.03	15.1
TkA01G585570	`PF11871`	DUF3391	171	218	9.4	7.5
TkA01G585570	`PF09872`	DUF2099	174	234	0.026	14.5
TkA01G585570	`PF23442`	DUF7125	192	247	0.12	12.5
TkA01G585570	`PF11871`	DUF3391	220	282	9.4	7.5
TkA01G585570	`PF00076`	RRM_1	308	364	3.9e-12	46.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FME2`	Arabidopsis thaliana	sp\|Q9FME2\|NTF2_ARATH Nuclear transport factor 2	45.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card